| Sequence ID | dm3.chr2L |
|---|---|
| Location | 19,280,475 – 19,280,568 |
| Length | 93 |
| Max. P | 0.744240 |
| Location | 19,280,475 – 19,280,568 |
|---|---|
| Length | 93 |
| Sequences | 7 |
| Columns | 94 |
| Reading direction | forward |
| Mean pairwise identity | 84.71 |
| Shannon entropy | 0.27925 |
| G+C content | 0.39337 |
| Mean single sequence MFE | -22.19 |
| Consensus MFE | -13.23 |
| Energy contribution | -15.23 |
| Covariance contribution | 2.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.25 |
| Structure conservation index | 0.60 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.56 |
| SVM RNA-class probability | 0.744240 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 19280475 93 + 23011544 UACAUAGAAAUGCUAAAAACAAUGAGCAAAAAUGCUGUUCUGAAAACGAGCUAAAAA-CGAGCUAAGAGCAGCAUUUCCGCUUGGUUUGACUUC ................((((...((((..((((((((((((.......((((.....-..)))).))))))))))))..)))).))))...... ( -25.10, z-score = -3.06, R) >droSim1.chr2L 18971469 93 + 22036055 UACAUAGAAAUGCUAAAAACAAUGAGCAAAAAUGCUGUUCUGAAAACGAGCUAAAAA-CGAGCUAAGAGCAGCAUUUCCGCUUGGUUUGACUUC ................((((...((((..((((((((((((.......((((.....-..)))).))))))))))))..)))).))))...... ( -25.10, z-score = -3.06, R) >droSec1.super_7 2909020 93 + 3727775 UACAUAGAAAUGCUAAAAACAAUGAGCAAAAAUGCUGUUCUGAAAACGAGCUAAAAA-CGAGCUAAGAGCAGCAUUUCCGCUUGGUUUGACUUC ................((((...((((..((((((((((((.......((((.....-..)))).))))))))))))..)))).))))...... ( -25.10, z-score = -3.06, R) >droYak2.chr2R 5788279 93 + 21139217 UACAUAGAAAUGCUAAAAACAAUGAGCAAAAAUGCUGUUCUGAAAACGAGCUAAAAA-CGAGCUAAGAGCAGCAUUUCCGCUUGGUUUGACUUC ................((((...((((..((((((((((((.......((((.....-..)))).))))))))))))..)))).))))...... ( -25.10, z-score = -3.06, R) >droEre2.scaffold_4845 17587149 93 - 22589142 UACAUAGAAAUGCUAAAAACAAUGAGCACAAAUGCUGUUCUGAAAACGAGCUAAAAA-CGAGCUAAGAGCAGCAUUUCCGCCUGGCUUGACUUC ...........((((........(.((..((((((((((((.......((((.....-..)))).))))))))))))..)))))))........ ( -21.00, z-score = -1.52, R) >droVir3.scaffold_12723 3219709 74 + 5802038 --------------AAAAACAAUGCA-GCAAAUGCUGG-----AAACGAGCUAAAAAACUAGCUAAAAGCUGCAUUUCCGCUUGGCUUGACUUC --------------......((((((-((......((.-----...))(((((......)))))....)))))))).................. ( -18.50, z-score = -1.78, R) >droGri2.scaffold_15126 8141274 76 - 8399593 --------------AAAAACAAUGCA-ACAACUGCUGGU--GGAAACGAGCUAAAAA-CUAGCUAAGAGCUGCAUUUCCGCUUGGCUUGACUUC --------------.....((..(((-.....)))...)--)....((((((((...-..(((.....)))((......))))))))))..... ( -15.40, z-score = -0.21, R) >consensus UACAUAGAAAUGCUAAAAACAAUGAGCAAAAAUGCUGUUCUGAAAACGAGCUAAAAA_CGAGCUAAGAGCAGCAUUUCCGCUUGGUUUGACUUC .........................((..((((((((((((.......((((........)))).))))))))))))..))............. (-13.23 = -15.23 + 2.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:51:50 2011