| Sequence ID | dm3.chr2L |
|---|---|
| Location | 18,914,063 – 18,914,153 |
| Length | 90 |
| Max. P | 0.519790 |
| Location | 18,914,063 – 18,914,153 |
|---|---|
| Length | 90 |
| Sequences | 3 |
| Columns | 90 |
| Reading direction | forward |
| Mean pairwise identity | 72.48 |
| Shannon entropy | 0.36913 |
| G+C content | 0.31891 |
| Mean single sequence MFE | -16.40 |
| Consensus MFE | -9.59 |
| Energy contribution | -10.82 |
| Covariance contribution | 1.23 |
| Combinations/Pair | 1.10 |
| Mean z-score | -1.63 |
| Structure conservation index | 0.58 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.05 |
| SVM RNA-class probability | 0.519790 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 18914063 90 + 23011544 UAUAAACAAGCAAUGCCUGCAUUUAGCCAGAUAGCUAAAAUGUUUAAAAAAAAAUGUUAGAUUUUUAUUUUCUGUGUAGGGAAAUCAAUU ..((((((.(((.....))).((((((......)))))).))))))...((((((.....))))))(((((((.....)))))))..... ( -14.20, z-score = -0.13, R) >droEre2.scaffold_4845 17225750 74 - 22589142 UAUAACCUAGCAAGGCCUGCACUUAGUCAGAAAGCUAAAAC---UAGA-------------UUUUUACUUCCUGUGUAGGUGAACCAAUU ..............((((((((..(((.(((((.(((....---))).-------------))))))))....))))))))......... ( -16.70, z-score = -1.37, R) >droYak2.chr2R 5430686 77 + 21139217 UAUAAACAAUGAACGCCUGCAUUUAACCAGAAAGCUAAAAC---UAGAAGAG----------UUUAAUUUUCUGUGUAGGUGAAUCAAUU .........(((.((((((((......(((((((...((((---(.....))----------)))..)))))))))))))))..)))... ( -18.30, z-score = -3.40, R) >consensus UAUAAACAAGCAACGCCUGCAUUUAGCCAGAAAGCUAAAAC___UAGAA_A__________UUUUUAUUUUCUGUGUAGGUGAAUCAAUU .............((((((((......(((((((.(((((......................))))))))))))))))))))........ ( -9.59 = -10.82 + 1.23)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:50:58 2011