| Sequence ID | dm3.chr2L |
|---|---|
| Location | 18,606,796 – 18,606,849 |
| Length | 53 |
| Max. P | 0.979757 |
| Location | 18,606,796 – 18,606,849 |
|---|---|
| Length | 53 |
| Sequences | 4 |
| Columns | 57 |
| Reading direction | reverse |
| Mean pairwise identity | 56.36 |
| Shannon entropy | 0.69561 |
| G+C content | 0.35692 |
| Mean single sequence MFE | -9.28 |
| Consensus MFE | -2.94 |
| Energy contribution | -3.25 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.56 |
| Mean z-score | -2.37 |
| Structure conservation index | 0.32 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.03 |
| SVM RNA-class probability | 0.979757 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 18606796 53 - 23011544 UACCAUAAAUACCACUGGAAACCACUAUCAGGAACAACACACUUAUCGAUAAC---- ..(((..........)))...((.......)).....................---- ( -1.30, z-score = 0.81, R) >droEre2.scaffold_4845 16924472 53 + 22589142 GUUCGAAAAUCCCAUAAGAAACCACUAUCGGUAAUACAACACUUAUCGAUAGU---- .......................(((((((((((........)))))))))))---- ( -11.10, z-score = -3.54, R) >droSec1.super_7 2233180 53 - 3727775 UACCAUAAAUACCAAUGGAAACCACUAUCGGUAACAACACACUUAUCGAUAAC---- ..((((........)))).......(((((((((........)))))))))..---- ( -10.30, z-score = -4.48, R) >droWil1.scaffold_180772 5869161 57 + 8906247 AUCGUUCGAUAACUUAUCGAACUAGUGAUGAGAGCGUGAAUCAUUUUUAUGUUUAAC ...((((((((...)))))))).........(((((((((.....)))))))))... ( -14.40, z-score = -2.29, R) >consensus UACCAUAAAUACCAUAGGAAACCACUAUCGGGAACAACACACUUAUCGAUAAC____ .........................(((((((((........)))))))))...... ( -2.94 = -3.25 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:50:16 2011