| Sequence ID | dm3.chr2L |
|---|---|
| Location | 18,399,317 – 18,399,371 |
| Length | 54 |
| Max. P | 0.996232 |
| Location | 18,399,317 – 18,399,371 |
|---|---|
| Length | 54 |
| Sequences | 3 |
| Columns | 54 |
| Reading direction | forward |
| Mean pairwise identity | 98.77 |
| Shannon entropy | 0.01701 |
| G+C content | 0.37654 |
| Mean single sequence MFE | -11.35 |
| Consensus MFE | -11.35 |
| Energy contribution | -11.35 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -3.04 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.90 |
| SVM RNA-class probability | 0.996232 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 18399317 54 + 23011544 UAUUUUCAGAAUCCCUCCUUUCUUCACUAUUCAACUGGGCGAUUCUGAUUCAUA .....(((((((((((....................))).))))))))...... ( -11.35, z-score = -3.03, R) >droSec1.super_7 2027193 54 + 3727775 UAUUUUCAGAAUCCCUCCUUUCUUCACUAUUCAACUGGGCGAUUCUGAUUCAUA .....(((((((((((....................))).))))))))...... ( -11.35, z-score = -3.03, R) >droSim1.chr2L 18091325 54 + 22036055 UAUUUUCAGAAUCCCUCCUUUCUUCACUAUUCAACUGGGCGAUUCUGAUUCCUA .....(((((((((((....................))).))))))))...... ( -11.35, z-score = -3.04, R) >consensus UAUUUUCAGAAUCCCUCCUUUCUUCACUAUUCAACUGGGCGAUUCUGAUUCAUA .....(((((((((((....................))).))))))))...... (-11.35 = -11.35 + -0.00)
| Location | 18,399,317 – 18,399,371 |
|---|---|
| Length | 54 |
| Sequences | 3 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 98.77 |
| Shannon entropy | 0.01701 |
| G+C content | 0.37654 |
| Mean single sequence MFE | -13.30 |
| Consensus MFE | -13.30 |
| Energy contribution | -13.30 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.80 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.70 |
| SVM RNA-class probability | 0.994462 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 18399317 54 - 23011544 UAUGAAUCAGAAUCGCCCAGUUGAAUAGUGAAGAAAGGAGGGAUUCUGAAAAUA ......((((((((.(((..((..........))..)).).))))))))..... ( -13.30, z-score = -2.85, R) >droSec1.super_7 2027193 54 - 3727775 UAUGAAUCAGAAUCGCCCAGUUGAAUAGUGAAGAAAGGAGGGAUUCUGAAAAUA ......((((((((.(((..((..........))..)).).))))))))..... ( -13.30, z-score = -2.85, R) >droSim1.chr2L 18091325 54 - 22036055 UAGGAAUCAGAAUCGCCCAGUUGAAUAGUGAAGAAAGGAGGGAUUCUGAAAAUA ......((((((((.(((..((..........))..)).).))))))))..... ( -13.30, z-score = -2.70, R) >consensus UAUGAAUCAGAAUCGCCCAGUUGAAUAGUGAAGAAAGGAGGGAUUCUGAAAAUA ......((((((((.(((..((..........))..)).).))))))))..... (-13.30 = -13.30 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:50:00 2011