Sequence ID | dm3.chr2L |
---|---|
Location | 18,386,447 – 18,386,506 |
Length | 59 |
Max. P | 0.951191 |
Location | 18,386,447 – 18,386,506 |
---|---|
Length | 59 |
Sequences | 5 |
Columns | 61 |
Reading direction | forward |
Mean pairwise identity | 86.76 |
Shannon entropy | 0.21303 |
G+C content | 0.64050 |
Mean single sequence MFE | -23.60 |
Consensus MFE | -17.76 |
Energy contribution | -18.16 |
Covariance contribution | 0.40 |
Combinations/Pair | 1.00 |
Mean z-score | -2.27 |
Structure conservation index | 0.75 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.11 |
SVM RNA-class probability | 0.893119 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 18386447 59 + 23011544 CCGUUUAGGCCAUUUAGGCCGCCUUCGCCACU--CCCAAUAAAGGGGCGUGGCUCUUGGCC .......((((.....))))(((...((((((--(((......)))).)))))....))). ( -27.10, z-score = -2.81, R) >droEre2.scaffold_4845 16706759 52 - 22589142 ---------CCGUUUAGGCCGCCUUCGCCUGCGCCCCAACAAAGGGGCGUGGCUCUUGGCC ---------.......(((((.....(((.(((((((......))))))))))...))))) ( -26.20, z-score = -2.33, R) >droYak2.chr2R 4903479 50 + 21139217 ---------CCGUUUAGGCCGCCUUUGCCACU--CCCAAUAAAGGGGCGUGGCUCUUGGCC ---------.......(((((.....((((((--(((......)))).)))))...))))) ( -21.80, z-score = -2.09, R) >droSec1.super_7 2013002 50 + 3727775 ---------CCGUUUAGGCCGCCUUCGCCACU--CCCAAUAAAGGGGCGUGGCUCUUGGCC ---------.......(((((.....((((((--(((......)))).)))))...))))) ( -21.10, z-score = -1.89, R) >droSim1.chr2L 18074065 50 + 22036055 ---------CCGUUUAGGCCGCCUUCGCCACU--CCCAAUAAUGGGGCGUGGCUCUUGGCC ---------.......(((((.....((((((--((((....))))).)))))...))))) ( -21.80, z-score = -2.25, R) >consensus _________CCGUUUAGGCCGCCUUCGCCACU__CCCAAUAAAGGGGCGUGGCUCUUGGCC ................(((((.....(((((...(((......)))..)))))...))))) (-17.76 = -18.16 + 0.40)
Location | 18,386,447 – 18,386,506 |
---|---|
Length | 59 |
Sequences | 5 |
Columns | 61 |
Reading direction | reverse |
Mean pairwise identity | 86.76 |
Shannon entropy | 0.21303 |
G+C content | 0.64050 |
Mean single sequence MFE | -24.22 |
Consensus MFE | -19.88 |
Energy contribution | -20.28 |
Covariance contribution | 0.40 |
Combinations/Pair | 1.00 |
Mean z-score | -2.26 |
Structure conservation index | 0.82 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.57 |
SVM RNA-class probability | 0.951191 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 18386447 59 - 23011544 GGCCAAGAGCCACGCCCCUUUAUUGGG--AGUGGCGAAGGCGGCCUAAAUGGCCUAAACGG .(((....(((((..(((......)))--.)))))...)))((((.....))))....... ( -28.30, z-score = -2.89, R) >droEre2.scaffold_4845 16706759 52 + 22589142 GGCCAAGAGCCACGCCCCUUUGUUGGGGCGCAGGCGAAGGCGGCCUAAACGG--------- ((((....(((.((((((......))))))..)))......)))).......--------- ( -25.70, z-score = -1.77, R) >droYak2.chr2R 4903479 50 - 21139217 GGCCAAGAGCCACGCCCCUUUAUUGGG--AGUGGCAAAGGCGGCCUAAACGG--------- ((((....(((((..(((......)))--.)))))......)))).......--------- ( -21.30, z-score = -1.79, R) >droSec1.super_7 2013002 50 - 3727775 GGCCAAGAGCCACGCCCCUUUAUUGGG--AGUGGCGAAGGCGGCCUAAACGG--------- ((((....(((((..(((......)))--.)))))......)))).......--------- ( -22.40, z-score = -2.08, R) >droSim1.chr2L 18074065 50 - 22036055 GGCCAAGAGCCACGCCCCAUUAUUGGG--AGUGGCGAAGGCGGCCUAAACGG--------- ((((....(((((..((((....))))--.)))))......)))).......--------- ( -23.40, z-score = -2.74, R) >consensus GGCCAAGAGCCACGCCCCUUUAUUGGG__AGUGGCGAAGGCGGCCUAAACGG_________ ((((....(((((..(((......)))...)))))......))))................ (-19.88 = -20.28 + 0.40)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:49:57 2011