Sequence ID | dm3.chr2L |
---|---|
Location | 17,280,509 – 17,280,603 |
Length | 94 |
Max. P | 0.898444 |
Location | 17,280,509 – 17,280,603 |
---|---|
Length | 94 |
Sequences | 5 |
Columns | 97 |
Reading direction | forward |
Mean pairwise identity | 63.12 |
Shannon entropy | 0.66873 |
G+C content | 0.36464 |
Mean single sequence MFE | -19.20 |
Consensus MFE | -10.50 |
Energy contribution | -11.34 |
Covariance contribution | 0.84 |
Combinations/Pair | 1.39 |
Mean z-score | -0.82 |
Structure conservation index | 0.55 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.14 |
SVM RNA-class probability | 0.898444 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 17280509 94 + 23011544 -CACAAAAAAAGUGGUUGGUGAUGCAUUUAGAAAUGGGAUUUUU--AGGGGAUGUAUUGACCUCUGAAUAAAUUCCAUUUGUACGAAAUUCUUUGAA -(((.......))).(..(.((......((.(((((((((((((--(((((.........)))))))..))))))))))).))......)).)..). ( -20.40, z-score = -1.26, R) >droAna3.scaffold_12916 12599193 93 - 16180835 ----AAAAGAAAAGCCAAAUCGUGUGAUGGGAUGUUUGUUAUUAGAAAGUGGUUUUUCCACUUCUCUCCACCGGCUUUAAGCCCGAAUUUAUGUGAA ----...............(((..((((((((((.....))))(((((((((.....)))))).))))))(.(((.....))).)...)))..))). ( -18.40, z-score = -0.23, R) >droEre2.scaffold_4845 15617704 73 - 22589142 ----------------------UGCAUUUAGAUAUGGGAUUUUU--GGGGGAUGUAUUGACCUCCGCGGACAUCACAUUUCUACUGAAGUUUUAGAA ----------------------............(((((((((.--.((..((((..((.((.....)).))..))))..))...)))))))))... ( -15.90, z-score = -0.84, R) >droSec1.super_7 902038 94 + 3727775 -CAAAAAAAAAGUGGUUGGUGAUGCAUUUAGAAAUGGGAUUUUU--AGGGGAUGUAUUGACCUCUGGAUAAAUGCCAUUUGUACGAAGUUCCAUGAA -..............((.(((..((.((((.((((((.((((((--(((((.........))))))))..))).)))))).)).)).))..))).)) ( -18.70, z-score = -0.33, R) >droSim1.chr2L 16976294 95 + 22036055 CAAAAAAAAAAGUGGUUGGUGAUGCAUUUAGAAAUGGGAUUUUU--AGGGGAUGUAUUGACCUCUGGAUAAAUCCCAUUUGUACGAAAUUCCUUGAA .........(((..(((..((.((((......((((((((((((--(((((.........))))))))..))))))))))))))).)))..)))... ( -22.60, z-score = -1.46, R) >consensus __A_AAAAAAAGUGGUUGGUGAUGCAUUUAGAAAUGGGAUUUUU__AGGGGAUGUAUUGACCUCUGGAUAAAUCCCAUUUGUACGAAAUUCUUUGAA ............................((.(((((((((((....(((((.........)))))....))))))))))).)).............. (-10.50 = -11.34 + 0.84)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:47:36 2011