| Sequence ID | dm3.chr2L |
|---|---|
| Location | 17,234,336 – 17,234,395 |
| Length | 59 |
| Max. P | 0.908849 |
| Location | 17,234,336 – 17,234,395 |
|---|---|
| Length | 59 |
| Sequences | 5 |
| Columns | 59 |
| Reading direction | reverse |
| Mean pairwise identity | 95.93 |
| Shannon entropy | 0.06962 |
| G+C content | 0.47458 |
| Mean single sequence MFE | -18.28 |
| Consensus MFE | -16.28 |
| Energy contribution | -16.56 |
| Covariance contribution | 0.28 |
| Combinations/Pair | 1.11 |
| Mean z-score | -2.17 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.20 |
| SVM RNA-class probability | 0.908849 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 17234336 59 - 23011544 UGUCACUGUUGUGAAGCGGGUAGUAGGGAUCUUACAGCCGUUUUGCAGAUGUGUUGAUG ...(((..(((..((((((.(.(((((...)))))).))))))..)))..)))...... ( -19.30, z-score = -2.61, R) >droSim1.chr2L 16931884 59 - 22036055 UGUCACUGUUGUGAAGCGGGUAGUAGGGAUCUUACAGCCGUUUUGCAGAUGUGUUGAUG ...(((..(((..((((((.(.(((((...)))))).))))))..)))..)))...... ( -19.30, z-score = -2.61, R) >droSec1.super_7 860702 59 - 3727775 UGUCACUGUUGUGAAGCGGGUAGUAGGGAUCUUAGAGCCGUUUUGCAGAUGUGUUGAUG ...(((..(((..((((((.(...((....))...).))))))..)))..)))...... ( -16.60, z-score = -2.03, R) >droYak2.chr2R 17269125 59 + 21139217 UGUCACUGUUGUGGAGCGGGUUGUAGGGAUCUUGCAGCCAUUUUGCAGAUGUGUUGAUG ...(((..(((..(((..(((((((((...))))))))).)))..)))..)))...... ( -18.30, z-score = -1.71, R) >droEre2.scaffold_4845 15576507 59 + 22589142 UGUCACUGUUGUGAAGCGGGUUGUAGGGAUCUUACAGCCAUUUUGCAGAUGUGUUGAUG ...(((..(((..(((..(((((((((...))))))))).)))..)))..)))...... ( -17.90, z-score = -1.90, R) >consensus UGUCACUGUUGUGAAGCGGGUAGUAGGGAUCUUACAGCCGUUUUGCAGAUGUGUUGAUG ...(((..(((..((((((.(.(((((...)))))).))))))..)))..)))...... (-16.28 = -16.56 + 0.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:47:30 2011