| Sequence ID | dm3.chr2L |
|---|---|
| Location | 17,098,252 – 17,098,322 |
| Length | 70 |
| Max. P | 0.847445 |
| Location | 17,098,252 – 17,098,322 |
|---|---|
| Length | 70 |
| Sequences | 6 |
| Columns | 72 |
| Reading direction | reverse |
| Mean pairwise identity | 52.78 |
| Shannon entropy | 0.87814 |
| G+C content | 0.30927 |
| Mean single sequence MFE | -10.12 |
| Consensus MFE | -3.61 |
| Energy contribution | -3.42 |
| Covariance contribution | -0.19 |
| Combinations/Pair | 2.00 |
| Mean z-score | -1.02 |
| Structure conservation index | 0.36 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.90 |
| SVM RNA-class probability | 0.847445 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 17098252 70 - 23011544 -AUUUGCAUACAAUAAGUAUGCACAUUGAGCGUAUAAGACAAAUAAACUUAUAUGACUUU-GCUCAAUUAUU -...(((((((.....))))))).((((((((((((((.........)))))))......-))))))).... ( -18.10, z-score = -3.70, R) >droPer1.super_8 1312867 71 + 3966273 AUUCUAGUUCCUAUAAGU-CCCUCUGGAAACGCCCAAAUCUAGAACAUUUUUCUGAUUUUCAUUUCCUCAUA ..................-......(((((.(...(((((.((((.....))))))))).).)))))..... ( -7.80, z-score = -0.95, R) >dp4.chr4_group3 272160 67 + 11692001 ----UAGUUCCUAUAAGU-CGCUCUGGAAACCCCCAAAUCUCGAACAUUUUUUUGAUUUUCAUUUCGUCAUA ----............(.-((...(((......)))......(((.(((.....))).)))....)).)... ( -4.00, z-score = 0.95, R) >droAna3.scaffold_12916 12428936 59 + 16180835 --GUUCGACCCAAUUAA--AGCGUAAUUAAUGCAUUGAAUAGGGAAAUCUUUAUAAACAUAAU--------- --......(((..((((--.((((.....)))).))))...)))...................--------- ( -8.40, z-score = -1.28, R) >droSec1.super_7 729757 70 - 3727775 -AUUUGCAUCAAAGAAGUAUGCAUAUUGAGCGUAUAAGAUAAUCAAACUCAUAUGUUUUU-GCUCCAUUAUU -...((((((......).)))))....(((((...((.(((..........))).))..)-))))....... ( -9.00, z-score = 0.40, R) >droSim1.chr2L 16782969 70 - 22036055 -ACUUGCAUCAAAGAAGUAUGCAUAUUGAGCGUAUAAGACAAACAAACUCAUAUGUUUUU-GCUCAAUUAUU -...((((((......).))))).((((((((...((((((............)))))))-))))))).... ( -13.40, z-score = -1.53, R) >consensus _AUUUGCAUCCAAUAAGU_UGCACAUUGAACGCAUAAAACAAGAAAACUUAUAUGAUUUU_ACUCCAUUAUU .........................((((((....((((((.(((....))).))))))..))))))..... ( -3.61 = -3.42 + -0.19)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:47:10 2011