| Sequence ID | dm3.chr2L |
|---|---|
| Location | 17,062,969 – 17,063,059 |
| Length | 90 |
| Max. P | 0.714716 |
| Location | 17,062,969 – 17,063,059 |
|---|---|
| Length | 90 |
| Sequences | 6 |
| Columns | 90 |
| Reading direction | forward |
| Mean pairwise identity | 72.06 |
| Shannon entropy | 0.51351 |
| G+C content | 0.41280 |
| Mean single sequence MFE | -10.53 |
| Consensus MFE | -5.86 |
| Energy contribution | -6.08 |
| Covariance contribution | 0.22 |
| Combinations/Pair | 1.17 |
| Mean z-score | -1.18 |
| Structure conservation index | 0.56 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.49 |
| SVM RNA-class probability | 0.714716 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 17062969 90 + 23011544 AUCCGUGCAUAGAUUUUCAUGCACAUUUGCUUAAUAAAACCCAGACUCCCGCCAUUUCCAACCACCCACAAAUCCGCACGAAAGCUAAAC ....((((((.(.....)))))))...................................................((......))..... ( -8.70, z-score = -1.10, R) >droSec1.super_7 694908 90 + 3727775 AUCCGUGCAUAGAUUUUCAUGCACAUUUGCUUAAUAAAACCCAGACUCCCGCCAUUUCGAACCACCCCCAAAUCUGCACGAAAGCUAAAC ...((((((..(((((....(((....)))...................((......))..........))))))))))).......... ( -11.10, z-score = -1.62, R) >droYak2.chr2R 17100368 90 - 21139217 AUCCGUGCAUAGAUUUUCAUGCACAUUUGCUUAAUAAAACCCAGACUCCCGACAUUUCCAACCACCCCCAAAUCCGCACGAAAGCUAAAC ...(((((...(((((....(((....)))....................((....))...........))))).))))).......... ( -8.80, z-score = -1.38, R) >droEre2.scaffold_4845 15413964 89 - 22589142 AUCCGUGCAUAGAUUUUCAUGCACAUUUGCUUAAUAAAACCCAGACCCCCGCCAUUUGCAACCACCC-CAAAUCCGCACGAAAGCUAAAC ...(((((...(((((....(((....)))....................((.....))........-.))))).))))).......... ( -11.30, z-score = -1.85, R) >droGri2.scaffold_15252 16192879 75 + 17193109 AUUGCUGCAUAGAUUCUCUUGCAU-UUUGCUUAAUAAAA--------------AACCAAAACCAGCCAAAAAUACAAAUAAAAAAUAGGA ...((((((.((.....))))).(-((((.((.......--------------)).)))))..)))........................ ( -4.60, z-score = 1.42, R) >droMoj3.scaffold_6500 31483813 72 + 32352404 AUUCGUGCAUAGAUGCUCAUGCAU-UUCGGUUAAUAAAA--------------ACCCCAAUGCA--CAAAGA-AAAAGCGAGAGGCGAAA .(((((((((((((((....))))-)).((((......)--------------)))...)))))--).....-....((.....))))). ( -18.70, z-score = -2.57, R) >consensus AUCCGUGCAUAGAUUUUCAUGCACAUUUGCUUAAUAAAACCCAGACUCCCGCCAUUUCCAACCACCCACAAAUCCGCACGAAAGCUAAAC ....((((((........)))))).................................................................. ( -5.86 = -6.08 + 0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:47:02 2011