| Sequence ID | dm3.chr2L |
|---|---|
| Location | 16,357,930 – 16,358,029 |
| Length | 99 |
| Max. P | 0.572447 |
| Location | 16,357,930 – 16,358,029 |
|---|---|
| Length | 99 |
| Sequences | 6 |
| Columns | 104 |
| Reading direction | forward |
| Mean pairwise identity | 63.99 |
| Shannon entropy | 0.68849 |
| G+C content | 0.32317 |
| Mean single sequence MFE | -11.82 |
| Consensus MFE | -4.49 |
| Energy contribution | -5.18 |
| Covariance contribution | 0.70 |
| Combinations/Pair | 1.36 |
| Mean z-score | -1.10 |
| Structure conservation index | 0.38 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.16 |
| SVM RNA-class probability | 0.572447 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 16357930 99 + 23011544 -ACUUCGGUAAAAGAG---AGUCUGGCCCCAGAUAAACUUACAGCACUGAAAA-AAAUAAUAUCUAAUAAAACAUAAAUAUUAGACACAUAAAAAAGAAACCAC -..((((((....(((---.(((((....)))))...))).....))))))..-........(((((((.........)))))))................... ( -13.70, z-score = -2.55, R) >droEre2.scaffold_4845 19423390 98 + 22589142 -GCUUCGGUAAAAAAA-CGAGACUGGCCCCAGAUAAACUUACUACACUGAAAA-AAAUAGUAGCGUGUGACACAAGAAUAUUAGGCGCAAACCGUUUUAUA--- -((....))...((((-((...(((....))).......(((((...(....)-...)))))((((.(((..........))).))))....))))))...--- ( -17.00, z-score = -0.40, R) >droYak2.chr2R 2812462 91 + 21139217 -ACUUCGGUAAGAAAA--GAGUCUGGCCCCAGAUAAACUUACAACACUGAAAACAAAUAUGUACGAAUGAUACAAAACUAAUAAGCACAUACAA---------- -..(((((((((....--..(((((....)))))...)))))..........(((....))).))))...........................---------- ( -11.50, z-score = -1.04, R) >droSec1.super_5 5081724 100 + 5866729 -ACUUCGGUAAAAAAAGAGUCUCUGGCCCCAGAUAAACUUACAGCACUGAAAA-AAAUAAUAUCCAAUAACACAAGAAUAUUAGACACAUAAAAAAAACCAG-- -..((((((.....(((..(.((((....)))).)..))).....))))))..-...((((((.(..........).))))))...................-- ( -10.00, z-score = -1.17, R) >droSim1.chr2L 16065988 99 + 22036055 -ACUUCGGUAAAAAAA-AGAGUCUGGCCCCCCAUAAACUUAGAGCACUGAAAA-AAAUAAUAUCCAAUAUCACAAGAAUAUUAGACACAUAAAAAAAACCAG-- -((....)).......-...((((((............((((....))))...-...............((....))...))))))................-- ( -6.60, z-score = 0.23, R) >droGri2.scaffold_14978 560589 87 + 1124632 UACACGGGAAACAAAA------------CAGUAAACUUUUGGAAUUUUUCUAAGAAUUUAUUUCAAAUUAUUUGUAAUUCAUUUGCACACAAAAAUGGG----- ((((..(....)....------------.((((((.(((((((.....))))))).))))))..........))))..((((((........)))))).----- ( -12.10, z-score = -1.65, R) >consensus _ACUUCGGUAAAAAAA__GAGUCUGGCCCCAGAUAAACUUACAACACUGAAAA_AAAUAAUAUCCAAUAACACAAAAAUAUUAGACACAUAAAAAAAAA_A___ ...((((((...........(((((....)))))...........))))))..................................................... ( -4.49 = -5.18 + 0.70)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:44:53 2011