Locus 1960

Sequence ID dm3.chr2L
Location 15,099,426 – 15,099,499
Length 73
Max. P 0.866287
window2703

overview

Window 3

Location 15,099,426 – 15,099,499
Length 73
Sequences 14
Columns 87
Reading direction reverse
Mean pairwise identity 71.41
Shannon entropy 0.60935
G+C content 0.29984
Mean single sequence MFE -11.05
Consensus MFE -6.20
Energy contribution -7.32
Covariance contribution 1.11
Combinations/Pair 1.24
Mean z-score -0.96
Structure conservation index 0.56
Background model dinucleotide
Decision model sequence based alignment quality
SVM decision value 0.98
SVM RNA-class probability 0.866287
Prediction RNA
WARNING Out of training range. z-scores are NOT reliable.

Download alignment: ClustalW | MAF

>dm3.chr2L 15099426 73 - 23011544
----GGGCCAGGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG---AGAUCCGA-
----((..(.......(((((((((.((((((((.------.........)))))))).))))))))).......---.)..))..- ( -11.96, z-score =  -0.85, R)
>droSim1.chr2L 14844883 73 - 22036055
----GGGCCAGGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG---AGAUCCGA-
----((..(.......(((((((((.((((((((.------.........)))))))).))))))))).......---.)..))..- ( -11.96, z-score =  -0.85, R)
>droSec1.super_3 1361600 73 - 7220098
----GGGCCAGACUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG---AGAUCCGA-
----((..(.......(((((((((.((((((((.------.........)))))))).))))))))).......---.)..))..- ( -11.96, z-score =  -1.53, R)
>droYak2.chr2L 2091069 72 + 22324452
-----GGCCAGGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCACUUAAAUCAAAG----AGUUCCGA
-----((...((((..((((.((((.((((((((.------.........)))))))).)))).)))).......----)))))).. (  -7.00, z-score =   0.55, R)
>droEre2.scaffold_4929 6840203 71 - 26641161
-----GGCCAGGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAA-UAAAUGCAUUUAAAUCAAAG----AGUUCCGA
-----((...((((..(((((((((.(((.((((.------.........))))-))).))))))))).......----)))))).. (  -6.00, z-score =   1.03, R)
>droAna3.scaffold_12916 5395418 70 + 16180835
-------CCAGGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG----AGUUCCGA
-------.........(((((((((.((((((((.------.........)))))))).))))))))).......----........ ( -10.10, z-score =  -1.52, R)
>dp4.chr4_group1 2772933 64 + 5278887
-------------UAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG----AGAGCCGA
-------------...(((((((((.((((((((.------.........)))))))).))))))))).......----........ ( -10.10, z-score =  -2.29, R)
>droPer1.super_5 2694557 64 - 6813705
-------------UAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG---AGAGCCGA-
-------------...(((((((((.((((((((.------.........)))))))).))))))))).......---........- ( -10.10, z-score =  -2.29, R)
>droWil1.scaffold_180764 3717300 77 - 3949147
CAACCGGGGGAACUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG---AAACACGA-
....((((....))..(((((((((.((((((((.------.........)))))))).))))))))).......---.....)).- ( -12.10, z-score =  -1.94, R)
>droVir3.scaffold_12963 15704839 80 + 20206255
-GGACGCUGCAGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCGGAGCUCGGGUGGAGA
-...((((..((((..(((((((((.((((((((.------.........)))))))).))))))))).....))))..)))).... ( -18.20, z-score =  -1.40, R)
>droMoj3.scaffold_6500 23944379 77 + 32352404
----GGACAAAGCUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCGGAGCUCAAGUGCGGA
----(.((..((((..(((((((((.((((((((.------.........)))))))).))))))))).....))))...)).)... ( -15.00, z-score =  -1.64, R)
>droGri2.scaffold_15252 939643 74 - 17193109
-------GGAAGGUAAUUAAAUGUAAUUAAUUUUC------ACAUGCCACAAAAUUAAAUGCAUUUAAAUCCGAUCUCAAAUGCGGA
-------(((.((...(((((((((.((((((((.------.........)))))))).)))))))))..))..))).......... ( -12.80, z-score =  -1.39, R)
>apiMel3.Group4 6451371 80 - 10796202
-----UGUUAGGAAAAUUUAAUUUCAUUAAUUUUCUUCUCAACGUUCUCUAUAAUAUCAUGAAUUUU--UCAAUGCAAGAGAAACGA
-----((..(((((((((..........)))))))))..)).((((((((...((....(((.....--)))))...)))).)))). ( -11.40, z-score =  -0.83, R)
>triCas2.ChLG6 8744427 72 - 13544221
--------UCUGCAGAAUAGAUGAGGAAAUUUUUUU--UAAACUCGCUUUAGAACAAGUUGUUAAAACGUCAAU-----AAAUCCGA
--------...........((((....(((((.(((--((((.....))))))).))))).......))))...-----........ (  -6.00, z-score =   1.56, R)
>consensus
_____GGCCAGGCUAAUUAAAUGUAAUUAAUUUUC______ACAUGCCUCAAAAUUAAAUGCAUUUAAAUCAAAG___AAAUCCGGA
................(((((((((.((((((((................)))))))).)))))))))................... ( -6.20 =  -7.32 +   1.11) 

alignment

Postscript

secondary structure

Postscript

dotplot

Postscript


Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:42:11 2011