| Sequence ID | dm3.chr2L |
|---|---|
| Location | 14,867,022 – 14,867,116 |
| Length | 94 |
| Max. P | 0.714925 |
| Location | 14,867,022 – 14,867,116 |
|---|---|
| Length | 94 |
| Sequences | 6 |
| Columns | 98 |
| Reading direction | reverse |
| Mean pairwise identity | 72.38 |
| Shannon entropy | 0.52548 |
| G+C content | 0.34748 |
| Mean single sequence MFE | -18.67 |
| Consensus MFE | -9.84 |
| Energy contribution | -10.18 |
| Covariance contribution | 0.34 |
| Combinations/Pair | 1.47 |
| Mean z-score | -1.24 |
| Structure conservation index | 0.53 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.49 |
| SVM RNA-class probability | 0.714925 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 14867022 94 - 23011544 ----UUGGCAUGCUCUAAAAAUGGCAUACCUAAGAUGAAUUGUUAGACUAUUCAUUAAAUUUCCCUGAAAGAAUUUCGCAACUAAAGUGUACUGACAA ----..((.(((((........))))).)).........(((((((.((.((((...........)))))).....(((.......)))..))))))) ( -13.00, z-score = 0.17, R) >droEre2.scaffold_4929 6612373 94 - 26641161 ----CCGGUAUGCUCCAUAAAUGGCAUACCAAAGAUGGAUUGUUAGACCAUUCAUUAAAUUUUUGUGAAAGAAUUUCGCAACUAAAAUAUACUGACAA ----..((((((((........))))))))...(((((((.(.....).)))))))......(((((((.....)))))))................. ( -21.10, z-score = -2.60, R) >droYak2.chr2L 14971758 94 - 22324452 ----UCGGUAUGUCCUGUAAAUGGCAUACCAAAGAUGGAUUGUUAGAGCAUUCAUUAAAUUCUCCUGAAAGAAUUUCGCAACUGAAGGUUGCUGACAA ----..((((((((........))))))))...(((((((.((....)))))))))(((((((......))))))).(((((.....)))))...... ( -25.10, z-score = -2.18, R) >droSec1.super_3 1139165 94 - 7220098 ----UCGGUAUGCUCUAAAAAUGGCAUACUUAAGAUGGAUUGUUAGACUAUUCAUUACAUUUCACUGAAAGAAUUUCGCAACUCAAGUGUACUGACAA ----((((((((((.......(((.((.(((.((.((((.(((..((....))...))).))))))..))).)).))).......))))))))))... ( -15.74, z-score = -0.25, R) >droSim1.chr2L 14616223 94 - 22036055 ----CCGGUAUGCUCUAAAAAUGGCAUACCUAAGAUGGAUUGUUAGACUAUUCAUUAAAUUUCACUGAAAGAAUUUCGCAAGUAAAGUGUACUGACAA ----..((((((((........)))))))).........(((((((((..((((...........))))....((((....).)))..)).))))))) ( -18.50, z-score = -1.23, R) >droWil1.scaffold_180764 3345272 83 - 3949147 UUGAUUGGCUUGCCCU---UAUUAUAAAGGCAAAAUGGCUUUGUA---UAUGCAUUGCCUUAAUCAAAAUCAACUUCUUAAGCUAGCCG--------- ......((((.(((((---(......))))......(((..(((.---...)))..)))......................)).)))).--------- ( -18.60, z-score = -1.35, R) >consensus ____UCGGUAUGCUCUAAAAAUGGCAUACCUAAGAUGGAUUGUUAGACUAUUCAUUAAAUUUCACUGAAAGAAUUUCGCAACUAAAGUGUACUGACAA ......((((((((........))))))))...(((((((.........))))))).......................................... ( -9.84 = -10.18 + 0.34)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:41:40 2011