| Sequence ID | dm3.chr2L |
|---|---|
| Location | 14,832,186 – 14,832,240 |
| Length | 54 |
| Max. P | 0.653949 |
| Location | 14,832,186 – 14,832,240 |
|---|---|
| Length | 54 |
| Sequences | 5 |
| Columns | 54 |
| Reading direction | forward |
| Mean pairwise identity | 92.59 |
| Shannon entropy | 0.12954 |
| G+C content | 0.41111 |
| Mean single sequence MFE | -9.60 |
| Consensus MFE | -9.10 |
| Energy contribution | -9.10 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.20 |
| Mean z-score | -1.09 |
| Structure conservation index | 0.95 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.35 |
| SVM RNA-class probability | 0.653949 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 14832186 54 + 23011544 AUUGAAACUGGAGAGACUAGUCGUAACUUUUUUCUCCACCCAACCAUCUAACAC ........((((((((..(((....)))..))))))))................ ( -11.60, z-score = -2.46, R) >droSim1.chr2L 14580949 54 + 22036055 AUUGAAACUGGAGAGACUAGUUGGAACUUUUUUCUCCACCCAACCAUCUAACAC ........((((((((..(((....)))..))))))))................ ( -11.70, z-score = -1.87, R) >droSec1.super_3 1104612 54 + 7220098 AUUGAAACUGGAGAGACUAGUUGGAACUUUUUUCUCCACCCAACCAUCUAACAC ........((((((((..(((....)))..))))))))................ ( -11.70, z-score = -1.87, R) >droYak2.chr2L 14936441 54 + 22324452 AUUGAAACCGGGGAGACUAGUUGGAACUUUUUUCUUCAACCAACAAUCUAACAC .........(((((((..(((....)))..)))))))................. ( -7.80, z-score = 0.08, R) >droEre2.scaffold_4929 6577126 54 + 26641161 AUUGAAACCGGGCACACUAGUUGGAACUUUUUUCUCCACCCAACCAUCUAACAC .........(((.........((((.........)))))))............. ( -5.20, z-score = 0.64, R) >consensus AUUGAAACUGGAGAGACUAGUUGGAACUUUUUUCUCCACCCAACCAUCUAACAC .........(((((((..(((....)))..)))))))................. ( -9.10 = -9.10 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:41:36 2011