| Sequence ID | dm3.chr2L |
|---|---|
| Location | 14,408,176 – 14,408,270 |
| Length | 94 |
| Max. P | 0.646172 |
| Location | 14,408,176 – 14,408,270 |
|---|---|
| Length | 94 |
| Sequences | 6 |
| Columns | 96 |
| Reading direction | reverse |
| Mean pairwise identity | 69.31 |
| Shannon entropy | 0.58777 |
| G+C content | 0.32139 |
| Mean single sequence MFE | -18.67 |
| Consensus MFE | -8.94 |
| Energy contribution | -10.00 |
| Covariance contribution | 1.06 |
| Combinations/Pair | 1.41 |
| Mean z-score | -1.08 |
| Structure conservation index | 0.48 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.33 |
| SVM RNA-class probability | 0.646172 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 14408176 94 - 23011544 --UUAGCGCUUAUCGCCUAAUACAGCUCAGUGAUUAUUGCGAUUUCUUUUUCAGUGAGUUGGUUUAGCUAUCUAAUAUGGGAUAAAAUAUUAAUUG --...(((.....)))((((..(((((((.(((.................))).)))))))..)))).(((((......)))))............ ( -19.13, z-score = -0.72, R) >droSim1.chr2L 14155828 94 - 22036055 --UUAACGCUUAUCGCCUAAUACAGCUCAUUGAUUAAUGCGAUUUAUUUUUCAGUGAGCUGGUUUAGCUGUCUAAUAUAAGAUAAAAUAUUGGUUG --.((((.......((.(((..(((((((((((..((((.....))))..)))))))))))..)))))(((((......)))))........)))) ( -25.40, z-score = -3.28, R) >droSec1.super_3 667666 94 - 7220098 --UUAACGCUUAUCGCCUAAUACAGCUCAUUGAUUAAUGCGAUUUAUUUUUCAGUGAGCUGGUUUAGCUGUCUAAUAUUGGAUAAAAUAUGAAUAG --..........((((.(((..(((((((((((..((((.....))))..)))))))))))..)))))((((((....))))))......)).... ( -25.20, z-score = -3.18, R) >droYak2.chr2L 14512606 94 - 22324452 --AUAGGGCUUAUCGCUUAAUACAGCUCAUUGAUUAAUGCGAUUGCUUUUUUAGUGAGCUCGUUUAACUGUCUAAUAUUGGAAGUAAUUAUUAUUG --...((((.....))))...((((((((((((..((.((....))))..)))))))))).))...(((.((((....)))))))........... ( -18.40, z-score = -0.65, R) >droVir3.scaffold_12723 3017680 88 + 5802038 -UAAGGCACAUAUUUAUCUGUCCUUUUCUCUG--CAAACUAGUCUCUCAGUCUUUUA-CUGUUUUUAAGAUAACAUAUCAUAACAAAGCUUG---- -.((((.(((........)))))))......(--(............((((.....)-))).......((((...))))........))...---- ( -7.60, z-score = 0.59, R) >droEre2.scaffold_4929 6161487 96 - 26641161 UUUGCGCGCUUAUCGCUUAAUACAGCUCAUUGAUUAAUGCGAUUGGUUUUUUAGUAAGCUUGUUUAGCUGUCUAAUAUGGGAAUUAAUAAUAAUUG (((.((.(((.((((((((((.(((....)))))))).))))).)))...((((..((((.....))))..))))..)).)))............. ( -16.30, z-score = 0.74, R) >consensus __UUAGCGCUUAUCGCCUAAUACAGCUCAUUGAUUAAUGCGAUUUCUUUUUCAGUGAGCUGGUUUAGCUGUCUAAUAUGGGAAAAAAUAUUAAUUG .............((.((((..(((((((((((.................)))))))))))..)))).)).......................... ( -8.94 = -10.00 + 1.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:40:01 2011