| Sequence ID | dm3.chr2L |
|---|---|
| Location | 14,148,263 – 14,148,357 |
| Length | 94 |
| Max. P | 0.987295 |
| Location | 14,148,263 – 14,148,357 |
|---|---|
| Length | 94 |
| Sequences | 7 |
| Columns | 101 |
| Reading direction | forward |
| Mean pairwise identity | 71.29 |
| Shannon entropy | 0.56948 |
| G+C content | 0.28393 |
| Mean single sequence MFE | -19.41 |
| Consensus MFE | -9.88 |
| Energy contribution | -12.47 |
| Covariance contribution | 2.60 |
| Combinations/Pair | 1.32 |
| Mean z-score | -2.04 |
| Structure conservation index | 0.51 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.27 |
| SVM RNA-class probability | 0.987295 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 14148263 94 + 23011544 AAGAAAU--AUUAAAAAGGAUCGCUUGG-AAAAAAAUUUAAAUGUUUGACCAGGCGGUUCUUUUCCAGGCAUUUGCAUAUUCAAAUAAUUUUUUAUC---- (((((((--....(((((((((((((((-....((((......))))..)))))))))))))))....((....))...........)))))))...---- ( -23.40, z-score = -3.17, R) >droSim1.chr2L 13898385 93 + 22036055 AAGAAAU--AUUAAAAAGGAUCGCUUGG--AAAAAAUUUAAAUGUUUGACCAGGCGAUUCUUUUCCAGGAAUUUGCAUAUUCAAAUAAUUUUUUAUC---- (((((((--....(((((((((((((((--...((((......))))..)))))))))))))))....((((......)))).....)))))))...---- ( -24.90, z-score = -3.92, R) >droSec1.super_3 406402 93 + 7220098 AAGAAAU--AUUAAAAAGGAUCGCUUGG--AAAAAAUUUAAAUGUUUGACCAGGCGAUUCUUUUCCAGGAAUUUGCAUAUUCAAAUAAUUUUUUAUC---- (((((((--....(((((((((((((((--...((((......))))..)))))))))))))))....((((......)))).....)))))))...---- ( -24.90, z-score = -3.92, R) >droYak2.chr2L 14245919 95 + 22324452 AAGAAAU--AUUAAAAAGGAUCGCUUGGGAAAAAAAUUUAAAUGUUUGACCAGGCGAUUCUUUUCCAGCCAUUUGCAUAUUCAAAUAAUUUUUUAUC---- (((((((--....(((((((((((((((..(((...........)))..)))))))))))))))......(((((......))))).)))))))...---- ( -23.70, z-score = -3.12, R) >droEre2.scaffold_4929 15320307 94 - 26641161 AAGAAGU--AUUAAAAAGGAUCGCUUGG-AAAAAAAUUUAAAUGUUUGACCAGGCGAUUCUUUUCCAAGCAUUUGCAUAUUCAAAUAAUUUUUUAUC---- (((((((--....(((((((((((((((-....((((......))))..)))))))))))))))....((....))...........)))))))...---- ( -24.20, z-score = -3.70, R) >droAna3.scaffold_12916 4546454 85 - 16180835 AAAAAAUUAAACAAAAAGGGGCCGGUGGAAAAAAGCCUGACAUACCUGAA-AUACUAUUUCUUUUCA------UGCAUAUUCAAAAAAUUAU--------- ..................((((...(....)...))))........((((-(..........)))))------...................--------- ( -6.20, z-score = 1.72, R) >anoGam1.chr3L 20398609 78 - 41284009 -----------------------AUGAGUAAAUAUAAUGGCUCACUUGUAAUGGCAGUAUUUUCCCAAGCAUGUGUAUUUUCAAACAAUGUUUUAUGGUUA -----------------------.(((((..........))))).((((....)))).......((((((((.(((........))))))))...)))... ( -8.60, z-score = 1.84, R) >consensus AAGAAAU__AUUAAAAAGGAUCGCUUGG_AAAAAAAUUUAAAUGUUUGACCAGGCGAUUCUUUUCCAGGCAUUUGCAUAUUCAAAUAAUUUUUUAUC____ .............(((((((((((((((.....((((......))))..)))))))))))))))..................................... ( -9.88 = -12.47 + 2.60)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:39:28 2011