| Sequence ID | dm3.chr2L |
|---|---|
| Location | 13,706,590 – 13,706,683 |
| Length | 93 |
| Max. P | 0.941595 |
| Location | 13,706,590 – 13,706,683 |
|---|---|
| Length | 93 |
| Sequences | 3 |
| Columns | 93 |
| Reading direction | forward |
| Mean pairwise identity | 96.74 |
| Shannon entropy | 0.04667 |
| G+C content | 0.54588 |
| Mean single sequence MFE | -32.67 |
| Consensus MFE | -32.27 |
| Energy contribution | -32.27 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.73 |
| Structure conservation index | 0.99 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.47 |
| SVM RNA-class probability | 0.941595 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 13706590 93 + 23011544 GGGUGGUGGUGGCAGGUUGUUUUGGGCGGGGAAGUCCAAAAAAAAAAAAAGGUGAGCCACACGCCAGCAACAGCGAGCCGCAAAACAAAGCCA .(((.((.(((((..((((((...((((.((....)).............((....))...))))...))))))..)))))...))...))). ( -33.20, z-score = -1.91, R) >droSim1.chr2L 13465240 90 + 22036055 GGGUGGUGGUGGCAGGUUGUUUUGGGCGGCGAAGUCCAAAAAAAAAA---GGUGAGCCACACGCCAGCAACAGCGAGCCGCAAAACAAAGCCA .(((.((.(((((..((((((((((((......))))))........---((((.......))))...))))))..)))))...))...))). ( -32.40, z-score = -1.35, R) >droSec1.super_16 1834057 90 + 1878335 GGGUGGUGGUGGCAGGUUGUUUUGGGCGGAGAAGUCCAAAAAAAAAA---GGUGAGCCACACGCCAGCAACAGCGAGCCGCAAAACAAAGCCA .(((.((.(((((..((((((((((((......))))))........---((((.......))))...))))))..)))))...))...))). ( -32.40, z-score = -1.92, R) >consensus GGGUGGUGGUGGCAGGUUGUUUUGGGCGGAGAAGUCCAAAAAAAAAA___GGUGAGCCACACGCCAGCAACAGCGAGCCGCAAAACAAAGCCA .(((.((.(((((..((((((((((((......))))))...........((((.......))))...))))))..)))))...))...))). (-32.27 = -32.27 + 0.00)
| Location | 13,706,590 – 13,706,683 |
|---|---|
| Length | 93 |
| Sequences | 3 |
| Columns | 93 |
| Reading direction | reverse |
| Mean pairwise identity | 96.74 |
| Shannon entropy | 0.04667 |
| G+C content | 0.54588 |
| Mean single sequence MFE | -26.17 |
| Consensus MFE | -24.63 |
| Energy contribution | -24.63 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.50 |
| Structure conservation index | 0.94 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.55 |
| SVM RNA-class probability | 0.740686 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 13706590 93 - 23011544 UGGCUUUGUUUUGCGGCUCGCUGUUGCUGGCGUGUGGCUCACCUUUUUUUUUUUUUGGACUUCCCCGCCCAAAACAACCUGCCACCACCACCC ((((.((((((((.(((.....((..(......)..))..................((......)))))))))))))...))))......... ( -24.50, z-score = -1.08, R) >droSim1.chr2L 13465240 90 - 22036055 UGGCUUUGUUUUGCGGCUCGCUGUUGCUGGCGUGUGGCUCACC---UUUUUUUUUUGGACUUCGCCGCCCAAAACAACCUGCCACCACCACCC ((((.((((((((.(((..((....)).((((...((..((..---.........))..)).)))))))))))))))...))))......... ( -28.60, z-score = -1.96, R) >droSec1.super_16 1834057 90 - 1878335 UGGCUUUGUUUUGCGGCUCGCUGUUGCUGGCGUGUGGCUCACC---UUUUUUUUUUGGACUUCUCCGCCCAAAACAACCUGCCACCACCACCC ((((.((((((((.(((.....((..(......)..)).....---..........(((....))))))))))))))...))))......... ( -25.40, z-score = -1.45, R) >consensus UGGCUUUGUUUUGCGGCUCGCUGUUGCUGGCGUGUGGCUCACC___UUUUUUUUUUGGACUUCCCCGCCCAAAACAACCUGCCACCACCACCC ((((.((((((((.(((.....((..(......)..))..................((......)))))))))))))...))))......... (-24.63 = -24.63 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:38:35 2011