| Sequence ID | dm3.chr2L |
|---|---|
| Location | 13,585,388 – 13,585,483 |
| Length | 95 |
| Max. P | 0.593062 |
| Location | 13,585,388 – 13,585,483 |
|---|---|
| Length | 95 |
| Sequences | 5 |
| Columns | 113 |
| Reading direction | reverse |
| Mean pairwise identity | 55.56 |
| Shannon entropy | 0.73697 |
| G+C content | 0.27194 |
| Mean single sequence MFE | -12.93 |
| Consensus MFE | -4.96 |
| Energy contribution | -4.20 |
| Covariance contribution | -0.76 |
| Combinations/Pair | 1.50 |
| Mean z-score | -0.95 |
| Structure conservation index | 0.38 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.21 |
| SVM RNA-class probability | 0.593062 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 13585388 95 - 23011544 ----------------CAUUGUCAUCACAUCAUAGGAUUAAAUUUAAUAGAAUAAGUUAGAGCGUUUUCUAACAUUCACGUUAUUCACAUUUAAUGACU--UUAAUGUCGUUU ----------------.................................(((((((((((((....))))))).......))))))......((((((.--.....)))))). ( -12.21, z-score = -0.45, R) >droSim1.chr2L 13353395 95 - 22036055 ----------------CAUUGUCAUCACAUUAUAGGUUUAAAUUUAUUUGAAUAAUUUAGAGCGUUUUUUAACAUUCACGUUAUUCACAUUUAAUGACU--UCAAUGUCGUUU ----------------..........(((((..((..((((((.....((((((((...(((.(((....))).)))..)))))))).))))))...))--..)))))..... ( -12.20, z-score = -0.81, R) >droSec1.super_16 1722505 73 - 1878335 ----------------CAUUGUCAUCACAUCAUAGGCGUAAA----------------------UUUUUUAACAUUCACGUUAUUCACAUUUAAUGACU--UCAAUGUCGUUU ----------------..................(((((.((----------------------(........))).)))))..........((((((.--.....)))))). ( -7.60, z-score = -0.77, R) >droYak2.chr2L 10004957 111 - 22324452 CAUUAACUCGACAUCACACUAAUCGUGCGUUUAGGUUUUAAAUUUAACCGAAUAAAUUAUGGCGUAUUUCAAAAUUCACGUUAUUAAAUUUUAAUGACA--UAAAUGUCGUUU ........((((((..........(((.((((.((((........))))(((...............))).)))).)))(((((((.....))))))).--...))))))... ( -17.96, z-score = -0.86, R) >droVir3.scaffold_12723 521908 91 + 5802038 ----------------UAUUAGCUCAAUAUUUUUGACCGCGACUU-UCAGUAUAUUUC----UAUAACAUUAAUUUUGUAUUGUUUAAAAGUCAAAGCUUAUCAAUGCUUUU- ----------------.....((((((.....))))..))(((((-((((((((....----((......))....)))))))....))))))(((((........))))).- ( -14.70, z-score = -1.86, R) >consensus ________________CAUUGUCAUCACAUUAUAGGCUUAAAUUUAACAGAAUAAUUUA__GCGUUUUUUAACAUUCACGUUAUUCACAUUUAAUGACU__UCAAUGUCGUUU ............................................................................................((((((........)))))). ( -4.96 = -4.20 + -0.76)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:38:22 2011