| Sequence ID | dm3.chr2L |
|---|---|
| Location | 13,513,657 – 13,513,731 |
| Length | 74 |
| Max. P | 0.939159 |
| Location | 13,513,657 – 13,513,731 |
|---|---|
| Length | 74 |
| Sequences | 6 |
| Columns | 81 |
| Reading direction | forward |
| Mean pairwise identity | 74.25 |
| Shannon entropy | 0.46760 |
| G+C content | 0.29102 |
| Mean single sequence MFE | -11.92 |
| Consensus MFE | -7.39 |
| Energy contribution | -7.53 |
| Covariance contribution | 0.14 |
| Combinations/Pair | 1.31 |
| Mean z-score | -1.70 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.45 |
| SVM RNA-class probability | 0.939159 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 13513657 74 + 23011544 -------CAAAAUAAUAUUUGCCGAGCUGCUCAAUUUUGUUUGGCAAAUAUUUUUGCCUUAUUAUUAGACUACCUACUUAU -------(((((..(((((((((((((...........))))))))))))))))))......................... ( -16.70, z-score = -3.04, R) >droEre2.scaffold_4929 14705103 81 - 26641161 CUAUCAUAUGAAUAAUAUUUACCGAGCUGCUCGAUUUUGUUUGGCAAAUAUUUUUACCUUAUUAUUAGACAACCUACUUAU (((..(((..((.(((((((.((((((...........)))))).))))))).))....)))...)))............. ( -10.30, z-score = -1.29, R) >droYak2.chr2L 9942405 81 + 22324452 CUAUCAUAUGAAUAAUAUUUACCAAGCUGCUCGAUUUAGUUUGGCAAAUAUUUUUACCUUAUUAUUACAUUACCUACAUAU ........((((.(((((((.((((((((.......)))))))).)))))))))))......................... ( -12.50, z-score = -2.47, R) >droSec1.super_16 1658909 74 + 1878335 -------CUAAAUAAUAUUUACCGAGCUGCUCAAUUUUGUUUGGCAAAUAUUUUUGCCUUAUUAUUAGACUACCUACUUAU -------((((.(((((......(((...)))..........((((((....)))))).)))))))))............. ( -11.10, z-score = -1.69, R) >droSim1.chr2L_random 507483 74 + 909653 -------CUAAAUAAUAUUUACCGAGCUGCUCAAUUUUGUUUGGCAAAUAUUUUUGCCUUAUUAUUAGACUACCUACUUAU -------((((.(((((......(((...)))..........((((((....)))))).)))))))))............. ( -11.10, z-score = -1.69, R) >triCas2.ChLG6 12991699 71 + 13544221 -------CAAAAUAACAUUC-CUGAGACGCUGGACCAAUUUCUCU--GUAUUUAAGCUGAAGAAAUCGGAUAUUUAUGUUU -------......(((((((-(.........)))((.(((((((.--((......)).).)))))).))......))))). ( -9.80, z-score = -0.01, R) >consensus _______CUAAAUAAUAUUUACCGAGCUGCUCAAUUUUGUUUGGCAAAUAUUUUUGCCUUAUUAUUAGACUACCUACUUAU .............(((((((.((((((...........)))))).)))))))............................. ( -7.39 = -7.53 + 0.14)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:38:08 2011