| Sequence ID | dm3.chr2L |
|---|---|
| Location | 12,836,113 – 12,836,194 |
| Length | 81 |
| Max. P | 0.644928 |
| Location | 12,836,113 – 12,836,194 |
|---|---|
| Length | 81 |
| Sequences | 6 |
| Columns | 87 |
| Reading direction | reverse |
| Mean pairwise identity | 82.41 |
| Shannon entropy | 0.32946 |
| G+C content | 0.50377 |
| Mean single sequence MFE | -29.00 |
| Consensus MFE | -20.87 |
| Energy contribution | -22.10 |
| Covariance contribution | 1.23 |
| Combinations/Pair | 1.21 |
| Mean z-score | -1.45 |
| Structure conservation index | 0.72 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.32 |
| SVM RNA-class probability | 0.644928 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 12836113 81 - 23011544 -----UUGGGUUGGGUGAAGUCUGGGUUUGGCUUUAACUCUUGG-UUGGUUAAGUGCCGAGAGCUCUUGGCCCAAAUACCCCAAAGG -----(((((((((((.(((...(..(((((((((((((.....-..))))))).))))))..).))).))))))....)))))... ( -29.90, z-score = -1.74, R) >droSim1.chr2L 12630945 81 - 22036055 -----UUGGGUUGGGUAAAGUCUGGGUUUGGCUUUAACUCUUGG-UUGGUUAAGUGCCGAGGGCUCUUGGCCCAAAUACCCCAAAGG -----((((((..(((((((((.......))))))).(((((((-(.........))))))))..))..))))))............ ( -28.80, z-score = -1.12, R) >droSec1.super_16 999647 81 - 1878335 -----UUGGGUUGGGUGAAGUCUGUGUUUGGCUUUAACUCUUGG-UUGGUUAAGUGCCGAGGGCUCUUGGCCCAAAUACCCCAAAGG -----(((((((((((.(((...((.(((((((((((((.....-..))))))).)))))).)).))).))))))....)))))... ( -33.30, z-score = -3.04, R) >droYak2.chr2L 9258740 86 - 22324452 UUGGAUUGGGUUGGGUGAGGUCUGGGUUUGGCUUUAACUCUUGG-UUGGUUAAGUGCCGAGGGCUCUUGGCCCAAAUACCCCAAAGG ((((.((((((..(((((((((.......))))))).(((((((-(.........))))))))..))..)))))).....))))... ( -30.20, z-score = -0.76, R) >droEre2.scaffold_4929 14037679 81 + 26641161 -----UUGGGUUGGUUGGGGUCUGGGUUUGGCUUUAACUCUUGG-UUGGUUAAGUGCCGAGGGCUCUUGGCCCAAAUACCCCAAAGG -----(((((...(((.(((((.((((((((((((((((.....-..))))))).)))))..))))..))))).)))..)))))... ( -30.70, z-score = -1.24, R) >droAna3.scaffold_12916 3591275 80 + 16180835 ------AUGGUUCAGAGCUACCCAGCUCUGGCUUUGGCUUUCGGAUUUGGCAAGUGUCGAGUACUCUUAA-UUAAAGACCUCAAAAG ------..(((((((((((....))))))))((((((.....(((((((((....))))))).)).....-)))))))))....... ( -21.10, z-score = -0.81, R) >consensus _____UUGGGUUGGGUGAAGUCUGGGUUUGGCUUUAACUCUUGG_UUGGUUAAGUGCCGAGGGCUCUUGGCCCAAAUACCCCAAAGG .....(((((((((((.(((...(..(((((((((((((........))))))).))))))..).))).))))))....)))))... (-20.87 = -22.10 + 1.23)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:35:58 2011