| Sequence ID | dm3.chrX |
|---|---|
| Location | 22,302,147 – 22,302,227 |
| Length | 80 |
| Max. P | 0.751098 |
| Location | 22,302,147 – 22,302,227 |
|---|---|
| Length | 80 |
| Sequences | 6 |
| Columns | 82 |
| Reading direction | forward |
| Mean pairwise identity | 60.71 |
| Shannon entropy | 0.74664 |
| G+C content | 0.29238 |
| Mean single sequence MFE | -8.57 |
| Consensus MFE | -4.59 |
| Energy contribution | -4.28 |
| Covariance contribution | -0.30 |
| Combinations/Pair | 1.83 |
| Mean z-score | -0.29 |
| Structure conservation index | 0.54 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.58 |
| SVM RNA-class probability | 0.751098 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 22302147 80 + 22422827 AAUAUUGUAUUAACAUGUAUCAAAUCUUGAGUUUAAUGUUAAACA--UCUUCGCUUACCCAGUGCUGCAUAAGCGCUUAUCA .....(((.(((((((...(((.....))).....))))))))))--.............((((((.....))))))..... ( -14.10, z-score = -1.43, R) >droAna3.scaffold_13230 1184357 75 - 3602488 -----AAUUAUAUUGGAAAAUAAUUGUACAGUUCAAUCUUAAAUAG--UUUUGAUAAUAUUUCACUUCAAACGCGAACACCA -----.....((((....))))........((((...((.....))--.(((((............)))))...)))).... ( -4.90, z-score = 0.95, R) >droYak2.chrX 21657077 65 + 21770863 ----------------GUAUAAAACCUUAAAUUUAAUGCCCAAAAA-UAUACACUUACCCAAUGCUGCAUAAGCAAUUAUCA ----------------(((((.........................-)))))..........((((.....))))....... ( -4.41, z-score = -0.08, R) >droEre2.scaffold_4690 18576750 73 + 18748788 ---------AAUACAAGUAUUACAUCUUCAAUUUAAUGCCGAAAAAAUAACCACUUACUCAUUGCUGCAUAAGCACUUAUCA ---------.......((((((.((.....)).)))))).......................((((.....))))....... ( -5.40, z-score = -0.24, R) >droSec1.super_39 244716 79 + 341166 -AAUAAGAUAAUAAAAGUAUUAUAUCUUGAGUUUAAUGUCAAAAA--UCGUCAAUUACCCAGUGCUGCAUAGGCACUUAUGA -.....((((.((((..((........))..)))).)))).....--.............((((((.....))))))..... ( -11.30, z-score = -0.47, R) >droSim1.chrX 17031986 79 + 17042790 -AAUAAGAUAAUAAAAGUAUUAUAUCUUGAGUUUAAUGUCAAAAA--UCGUCAAUUACCCAGUGCUGCAUAGGCACUUAUGA -.....((((.((((..((........))..)))).)))).....--.............((((((.....))))))..... ( -11.30, z-score = -0.47, R) >consensus _____AG_UAAUAAAAGUAUUAAAUCUUGAGUUUAAUGUCAAAAA__UCUUCAAUUACCCAGUGCUGCAUAAGCACUUAUCA ............................................................((((((.....))))))..... ( -4.59 = -4.28 + -0.30)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:07:56 2011