| Sequence ID | dm3.chrX |
|---|---|
| Location | 21,966,018 – 21,966,069 |
| Length | 51 |
| Max. P | 0.896187 |
| Location | 21,966,018 – 21,966,069 |
|---|---|
| Length | 51 |
| Sequences | 4 |
| Columns | 51 |
| Reading direction | forward |
| Mean pairwise identity | 70.26 |
| Shannon entropy | 0.48962 |
| G+C content | 0.35461 |
| Mean single sequence MFE | -10.95 |
| Consensus MFE | -5.06 |
| Energy contribution | -7.00 |
| Covariance contribution | 1.94 |
| Combinations/Pair | 1.31 |
| Mean z-score | -2.05 |
| Structure conservation index | 0.46 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.13 |
| SVM RNA-class probability | 0.896187 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 21966018 51 + 22422827 CUGUGUGUGAAAUUAAUAAACGGUAAGUUCGAAAGUUUAGUUUCACGCGAA ...(((((((((((((....(((.....))).....))))))))))))).. ( -15.00, z-score = -3.68, R) >droSec1.super_55 122678 51 + 187931 AUGUGUGUGAAAUUAAUAAACGGUAAGUUCGAAAGUUUAGUUUCACGCGAA ...(((((((((((((....(((.....))).....))))))))))))).. ( -15.00, z-score = -3.73, R) >droEre2.scaffold_4784 1590830 51 - 25762168 CUGUGCCGGAAAUUAAGAAACAGUGAGUUAGAUAAUUUAGUGUCGUGUGCA ..(..(((...........(((.((((((....)))))).))))).)..). ( -7.80, z-score = -0.46, R) >droVir3.scaffold_12734 178968 50 - 510240 GAGUGUGCACCAUCC-UAAAUAUUAACUUCAAAAGUUUAGUUGCAAGCAAA ..((.((((.....(-(((((.((.......)).)))))).)))).))... ( -6.00, z-score = -0.35, R) >consensus CUGUGUGUGAAAUUAAUAAACAGUAAGUUCGAAAGUUUAGUUUCACGCGAA ...(((((((((((((....(((.....))).....))))))))))))).. ( -5.06 = -7.00 + 1.94)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:07:28 2011