| Sequence ID | dm3.chrX |
|---|---|
| Location | 21,074,686 – 21,074,739 |
| Length | 53 |
| Max. P | 0.886408 |
| Location | 21,074,686 – 21,074,739 |
|---|---|
| Length | 53 |
| Sequences | 3 |
| Columns | 53 |
| Reading direction | reverse |
| Mean pairwise identity | 75.47 |
| Shannon entropy | 0.34178 |
| G+C content | 0.36055 |
| Mean single sequence MFE | -12.41 |
| Consensus MFE | -7.86 |
| Energy contribution | -7.87 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.17 |
| Mean z-score | -2.10 |
| Structure conservation index | 0.63 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.07 |
| SVM RNA-class probability | 0.886408 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 21074686 53 - 22422827 UGAGCUAAUAUAAGUUGGUUUUAAUUACGAACGGCUUGUAUUAAGCCAAAAAC ((.((((((((((((((..............))))))))))).)))))..... ( -13.54, z-score = -3.09, R) >droSec1.super_8 3382630 52 - 3762037 -GAGCUAAUAUAAGUUGGUUUUAAUUGCGAAUGGCUUGUAUCAAGCCAAAAAU -((((((((....))))))))..........(((((((...)))))))..... ( -13.10, z-score = -2.47, R) >droEre2.scaffold_4690 17605543 53 - 18748788 UGGCCCAAUCUAAGUUGGCCAUAAUUACGAACGGCUUAUACGAAGGCUUUUAC (((((.(((....))))))))...........(((((......)))))..... ( -10.60, z-score = -0.74, R) >consensus UGAGCUAAUAUAAGUUGGUUUUAAUUACGAACGGCUUGUAUCAAGCCAAAAAC ..(((((((....)))))))............(((((.....)))))...... ( -7.86 = -7.87 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:05:56 2011