| Sequence ID | dm3.chrX |
|---|---|
| Location | 20,998,179 – 20,998,230 |
| Length | 51 |
| Max. P | 0.871451 |
| Location | 20,998,179 – 20,998,230 |
|---|---|
| Length | 51 |
| Sequences | 5 |
| Columns | 55 |
| Reading direction | forward |
| Mean pairwise identity | 96.20 |
| Shannon entropy | 0.06563 |
| G+C content | 0.33309 |
| Mean single sequence MFE | -0.38 |
| Consensus MFE | -0.98 |
| Energy contribution | -0.98 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | 1.09 |
| Structure conservation index | 2.55 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.00 |
| SVM RNA-class probability | 0.871451 |
| Prediction | RNA |
| WARNING | Structure conservation index out of range. |
Download alignment: ClustalW | MAF
>dm3.chrX 20998179 51 + 22422827 ACCAGUUUCGCCUUAUUUAUAUUUACUUUGAUACC----ACUGUUUUCGUUUCGU ..((((.(((...((........))...)))....----))))............ ( -0.50, z-score = 1.03, R) >droSim1.chrX_random 265670 55 - 5698898 ACCAGUUUCGCCUUAUUUAUAUUUACUUUGAUACCUACCACUGUUUUCGUUUCGU ..((((.......((((............))))......))))............ ( -0.42, z-score = 1.08, R) >droSec1.super_8 3281863 51 + 3762037 ACCAGUUUCGCCUUAUUUAUAUUUACUUUGAUACC----ACUGUUUUCGUUUCGU ..((((.(((...((........))...)))....----))))............ ( -0.50, z-score = 1.03, R) >droYak2.chrX 20199276 51 + 21770863 ACCAGUUUCGCCUUAUUUAUAUUUACUUUGAUACC----ACUGUUUUCGUUUCGU ..((((.(((...((........))...)))....----))))............ ( -0.50, z-score = 1.03, R) >droEre2.scaffold_4690 17564057 50 + 18748788 ACCAGUUU-GCCUUAUUUAUAUUUACUUUGAUACC----ACUGUUUUCGUUUCGU ........-..........................----................ ( 0.00, z-score = 1.31, R) >consensus ACCAGUUUCGCCUUAUUUAUAUUUACUUUGAUACC____ACUGUUUUCGUUUCGU ..((((.......((((............))))......))))............ ( -0.98 = -0.98 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:05:43 2011