| Sequence ID | dm3.chrX |
|---|---|
| Location | 20,846,632 – 20,846,734 |
| Length | 102 |
| Max. P | 0.874818 |
| Location | 20,846,632 – 20,846,734 |
|---|---|
| Length | 102 |
| Sequences | 6 |
| Columns | 102 |
| Reading direction | forward |
| Mean pairwise identity | 79.87 |
| Shannon entropy | 0.39416 |
| G+C content | 0.31663 |
| Mean single sequence MFE | -19.84 |
| Consensus MFE | -13.80 |
| Energy contribution | -14.20 |
| Covariance contribution | 0.40 |
| Combinations/Pair | 1.36 |
| Mean z-score | -1.58 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.02 |
| SVM RNA-class probability | 0.874818 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 20846632 102 + 22422827 CCACGUUCAUUACAGCACAUUUGGGUUGAAUAAAUUUAAUUGUUUUUCCAUCAUAAAUUAUCGUGGCUCGCAUAUCCGUUGAUAAAAAUGGAAUUGCAUUCU (((((.......(((.....)))((..((((((......))))))..))............)))))...(((..((((((......))))))..)))..... ( -20.90, z-score = -1.33, R) >droSim1.chrX 16015149 102 + 17042790 CCACGUUCAUUACAGCACAUUUGGGUUGAAUAAAUUUAAUUGUUUUUCCAUCAUAAAUUAUCGUGGCUCGCAUAUCCGUUGAUAAAAAUGGAAUUGCAUUCU (((((.......(((.....)))((..((((((......))))))..))............)))))...(((..((((((......))))))..)))..... ( -20.90, z-score = -1.33, R) >droSec1.super_8 3129712 102 + 3762037 CCACGUUUAUUACAGCACAUUUGGGUUGAAUAAAUUUAAUUAUUUUUCCAUCAUAAAUUAUCGUGGCUCGCAUAUCCGUUGAUAAAAAUGGAAUUGCAUUCU (((((...(((.(((.....)))((..((((((......))))))..))......)))...)))))...(((..((((((......))))))..)))..... ( -21.40, z-score = -1.88, R) >droYak2.chrX 20058096 102 + 21770863 CCACGUUCAUUACAGCACAUUUGGGUUGAAUAAAUUUAAUUGUUUUUCCAUCAUAAAUUAUCGUGGUUCGCAUAUCCGUUGAUAAAAAUGGAAUUGCAUUCU (((((.......(((.....)))((..((((((......))))))..))............)))))...(((..((((((......))))))..)))..... ( -21.10, z-score = -1.46, R) >droEre2.scaffold_4690 17420312 102 + 18748788 CCGCGUUCAUUACAGCACAUUUGGGUUGAAUAAUUUUAAUUGUUUUUCCAUCAUAAAUUAUCGUGGCUCGCAUAUCCGUUGAUAAAAAUGGAAUUGCAUUCU (((((.......(((.....)))((..(((((((....)))))))..))............)))))...(((..((((((......))))))..)))..... ( -21.40, z-score = -1.18, R) >droVir3.scaffold_12970 5159830 91 + 11907090 -----ACAAUUUUACCA-AUGAAUGGCACACAAAUAUGUUUGCUAUUUAUUUAUUAACAUUUUUACCAGCAAUUUCUAAUUAUACAACUA-AUUUGCC---- -----...........(-((((((((((.(((....))).))))))))))).................((((..................-..)))).---- ( -13.35, z-score = -2.28, R) >consensus CCACGUUCAUUACAGCACAUUUGGGUUGAAUAAAUUUAAUUGUUUUUCCAUCAUAAAUUAUCGUGGCUCGCAUAUCCGUUGAUAAAAAUGGAAUUGCAUUCU (((((.......(((.....)))((..((((((......))))))..))............)))))...(((..((((((......))))))..)))..... (-13.80 = -14.20 + 0.40)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:05:19 2011