| Sequence ID | dm3.chrX |
|---|---|
| Location | 20,821,605 – 20,821,673 |
| Length | 68 |
| Max. P | 0.998430 |
| Location | 20,821,605 – 20,821,673 |
|---|---|
| Length | 68 |
| Sequences | 5 |
| Columns | 68 |
| Reading direction | forward |
| Mean pairwise identity | 95.88 |
| Shannon entropy | 0.07102 |
| G+C content | 0.57941 |
| Mean single sequence MFE | -25.54 |
| Consensus MFE | -21.98 |
| Energy contribution | -22.02 |
| Covariance contribution | 0.04 |
| Combinations/Pair | 1.05 |
| Mean z-score | -2.50 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.43 |
| SVM RNA-class probability | 0.939629 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 20821605 68 + 22422827 CGUGGCCCACACUUUUGGGCCAAAAUCGCCAGCGGUGUUUCGACGACGAAGCAAAAACGCCAACUAGC ..(((((((......))))))).........(((.(((((((....)))))))....)))........ ( -24.20, z-score = -2.33, R) >droSim1.chrX 15990267 68 + 17042790 CGUGGCCCACACUUUUGGGCCAAAAUCGCCAGCGGCGUUUCGACGACGAAGCAAAAACGCCAACUAGC ..(((((((......))))))).....((.((.(((((((...(......)...)))))))..)).)) ( -22.40, z-score = -1.68, R) >droSec1.super_8 3095332 68 + 3762037 CGUGGCCCACACUUUUGGGCCAAAAUCGCCAGCGGCGUUUCGACGACGAAGCAAAAACGCCAACUAGC ..(((((((......))))))).....((.((.(((((((...(......)...)))))))..)).)) ( -22.40, z-score = -1.68, R) >droYak2.chrX 20035959 68 + 21770863 CGUGGCCCCCACUUUUGGGCCAAAAUCGCCAGCGGCGUUUCGGCGACGAACCAAAAACGCCAACUGGC ..((((((........)))))).....(((((.(((((((((....)))......))))))..))))) ( -29.90, z-score = -2.91, R) >droEre2.scaffold_4690 17400615 68 + 18748788 CGUGGCCCACACUUUUGGGCCAAAAUCGCCAGCGGCGUUUCGACAACGAACCAAAAACGCCAACUGGC ..(((((((......))))))).....(((((.(((((((((....)))......))))))..))))) ( -28.80, z-score = -3.88, R) >consensus CGUGGCCCACACUUUUGGGCCAAAAUCGCCAGCGGCGUUUCGACGACGAAGCAAAAACGCCAACUAGC ..(((((((......))))))).....((.((.(((((((((....)))......))))))..)).)) (-21.98 = -22.02 + 0.04)
| Location | 20,821,605 – 20,821,673 |
|---|---|
| Length | 68 |
| Sequences | 5 |
| Columns | 68 |
| Reading direction | reverse |
| Mean pairwise identity | 95.88 |
| Shannon entropy | 0.07102 |
| G+C content | 0.57941 |
| Mean single sequence MFE | -33.38 |
| Consensus MFE | -31.64 |
| Energy contribution | -32.04 |
| Covariance contribution | 0.40 |
| Combinations/Pair | 1.09 |
| Mean z-score | -3.95 |
| Structure conservation index | 0.95 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 3.36 |
| SVM RNA-class probability | 0.998430 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 20821605 68 - 22422827 GCUAGUUGGCGUUUUUGCUUCGUCGUCGAAACACCGCUGGCGAUUUUGGCCCAAAAGUGUGGGCCACG ((((((.((.(((((.((......)).))))).)))))))).....(((((((......))))))).. ( -28.80, z-score = -3.02, R) >droSim1.chrX 15990267 68 - 17042790 GCUAGUUGGCGUUUUUGCUUCGUCGUCGAAACGCCGCUGGCGAUUUUGGCCCAAAAGUGUGGGCCACG ((((((.((((((((.((......)).)))))))))))))).....(((((((......))))))).. ( -34.20, z-score = -4.51, R) >droSec1.super_8 3095332 68 - 3762037 GCUAGUUGGCGUUUUUGCUUCGUCGUCGAAACGCCGCUGGCGAUUUUGGCCCAAAAGUGUGGGCCACG ((((((.((((((((.((......)).)))))))))))))).....(((((((......))))))).. ( -34.20, z-score = -4.51, R) >droYak2.chrX 20035959 68 - 21770863 GCCAGUUGGCGUUUUUGGUUCGUCGCCGAAACGCCGCUGGCGAUUUUGGCCCAAAAGUGGGGGCCACG ((((((.((((((((.(((.....))))))))))))))))).....((((((........)))))).. ( -36.40, z-score = -3.81, R) >droEre2.scaffold_4690 17400615 68 - 18748788 GCCAGUUGGCGUUUUUGGUUCGUUGUCGAAACGCCGCUGGCGAUUUUGGCCCAAAAGUGUGGGCCACG ((((((.((((((((.((.......)))))))))))))))).....(((((((......))))))).. ( -33.30, z-score = -3.90, R) >consensus GCUAGUUGGCGUUUUUGCUUCGUCGUCGAAACGCCGCUGGCGAUUUUGGCCCAAAAGUGUGGGCCACG ((((((.((((((((.((......)).)))))))))))))).....(((((((......))))))).. (-31.64 = -32.04 + 0.40)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:05:15 2011