| Sequence ID | dm3.chr2L |
|---|---|
| Location | 12,143,153 – 12,143,213 |
| Length | 60 |
| Max. P | 0.898936 |
| Location | 12,143,153 – 12,143,213 |
|---|---|
| Length | 60 |
| Sequences | 11 |
| Columns | 65 |
| Reading direction | reverse |
| Mean pairwise identity | 65.43 |
| Shannon entropy | 0.74489 |
| G+C content | 0.51297 |
| Mean single sequence MFE | -15.49 |
| Consensus MFE | -7.02 |
| Energy contribution | -7.67 |
| Covariance contribution | 0.65 |
| Combinations/Pair | 1.14 |
| Mean z-score | -0.99 |
| Structure conservation index | 0.45 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.14 |
| SVM RNA-class probability | 0.898936 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 12143153 60 - 23011544 UUUUCUCCGUUUCACUUCUUGUA---UUUUUGGGCAAACGCCCACGCGGCGCCAAACUGCGCA-- .......(((...((.....)).---....(((((....))))).)))((((......)))).-- ( -15.40, z-score = -1.22, R) >droSim1.chr2L 11942290 60 - 22036055 UGUUCUCCGUUUCACUUCUUGUA---UUUUUGGGCAAACGCCCACGCGGCGCCAAACUGCGCA-- .......(((...((.....)).---....(((((....))))).)))((((......)))).-- ( -15.40, z-score = -0.71, R) >droSec1.super_16 336436 60 - 1878335 UGUUCUCCGUUUCACUUCUUGUA---UUUUUUGGCAAACGCCCACGCGGCGCCAAACUGCGCA-- ...................((..---(..((((((...(((....)))..))))))..)..))-- ( -12.00, z-score = 0.08, R) >droYak2.chr2L 8562586 60 - 22324452 GUUUCUCGGUUUUACUUUUUGUA---UUUUUGGGCAAACGCCCACGCGGCGCCAAACUGCGCA-- ....(.((....(((.....)))---....(((((....))))))).)((((......)))).-- ( -15.70, z-score = -0.66, R) >droEre2.scaffold_4929 13371758 59 + 26641161 -GUCUUCGGUUUUACUUCUUGUA---UUUUUGGGCAAACGCCCACGCGGCGCCAAACUGCGCA-- -.....((....(((.....)))---....(((((....)))))..))((((......)))).-- ( -15.40, z-score = -0.57, R) >droAna3.scaffold_12916 2943134 64 + 16180835 -CGUUCUGCGUUUACUUCUUGUAUAAUUUUGGGGCAGACGCCCACGCGGCGCCAAACGCUGCGCA -......((((((.((((..(......)..)))).))))))...(((((((.....))))))).. ( -20.60, z-score = -0.66, R) >dp4.chr4_group3 5649894 60 + 11692001 --CUUUCGGUUUUAUUUCUUAGAC-UUUUGGGGGCAGACGCCCACACGGCGCCAAACGGCGCA-- --((...(((((........))))-)...))((((....)))).....(((((....))))).-- ( -19.80, z-score = -2.16, R) >droPer1.super_1 2746826 60 + 10282868 --CUUUCGGGUUUAUUUCUUAGAC-UUUUGGGGGCAGACGCCCACACGGCGCCAAACGGCGCA-- --....((((((((.....)))))-)..((.((((....)))).))))(((((....))))).-- ( -21.90, z-score = -2.68, R) >droGri2.scaffold_15252 11556691 52 + 17193109 ----UUUUGCCACAUACGUU------UUUGGAGGCAGACGCCCACGCGGCGCC-AUUUGCGCA-- ----.((((((.((......------..))..))))))(((....)))((((.-....)))).-- ( -16.70, z-score = -1.20, R) >droMoj3.scaffold_6500 957970 57 - 32352404 UUUUUUUCUUCAUGUUUCUU-----GUUUGGAGGCAGACGCCCACGCGGCGCC-AUUUGCGCA-- .........((.(((((((.-----....)))))))))(((....)))((((.-....)))).-- ( -15.30, z-score = -0.85, R) >apiMel3.Group6 9650553 56 + 14581788 UUUUUUUUCGCAUAGCAAUAAAAAAGCUACAACACAUAUCCCAAAAUUAUCACGUA--------- ............((((.........))))...........................--------- ( -2.20, z-score = -0.29, R) >consensus _UUUUUCGGUUUUACUUCUUGUA___UUUUGGGGCAAACGCCCACGCGGCGCCAAACUGCGCA__ ................................(((....)))......((((......))))... ( -7.02 = -7.67 + 0.65)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:34:29 2011