| Sequence ID | dm3.chr2L |
|---|---|
| Location | 12,120,718 – 12,120,772 |
| Length | 54 |
| Max. P | 0.852883 |
| Location | 12,120,718 – 12,120,772 |
|---|---|
| Length | 54 |
| Sequences | 3 |
| Columns | 54 |
| Reading direction | reverse |
| Mean pairwise identity | 97.53 |
| Shannon entropy | 0.03401 |
| G+C content | 0.29012 |
| Mean single sequence MFE | -5.97 |
| Consensus MFE | -5.97 |
| Energy contribution | -5.97 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.31 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.92 |
| SVM RNA-class probability | 0.852883 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 12120718 54 - 23011544 UUAUUCUCCUUUCUUUCUCAGCAAUUUGUAAUGCUUUUAAUAAGCAUAGGCACA ..........................(((.((((((.....))))))..))).. ( -6.50, z-score = -0.66, R) >droSim1.chr2L 11918389 54 - 22036055 UUAUUCUCCUUUCUUUCUCAACAAUUUGUAAUGCUUUUAAUAAGCAUAAGCACA ..........................(((.((((((.....))))))..))).. ( -5.70, z-score = -1.64, R) >droSec1.super_16 309149 54 - 1878335 UUAUUCUCCUUUCUUUCUCAACAAUUUGUAAUGCUUUUAAUAAGCAUAAGCACA ..........................(((.((((((.....))))))..))).. ( -5.70, z-score = -1.64, R) >consensus UUAUUCUCCUUUCUUUCUCAACAAUUUGUAAUGCUUUUAAUAAGCAUAAGCACA ..........................(((.((((((.....))))))..))).. ( -5.97 = -5.97 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:34:27 2011