| Sequence ID | dm3.chrX |
|---|---|
| Location | 20,235,119 – 20,235,178 |
| Length | 59 |
| Max. P | 0.703439 |
| Location | 20,235,119 – 20,235,178 |
|---|---|
| Length | 59 |
| Sequences | 4 |
| Columns | 64 |
| Reading direction | reverse |
| Mean pairwise identity | 90.79 |
| Shannon entropy | 0.14239 |
| G+C content | 0.57948 |
| Mean single sequence MFE | -16.05 |
| Consensus MFE | -12.75 |
| Energy contribution | -13.06 |
| Covariance contribution | 0.31 |
| Combinations/Pair | 1.06 |
| Mean z-score | -2.01 |
| Structure conservation index | 0.79 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.46 |
| SVM RNA-class probability | 0.703439 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 20235119 59 - 22422827 AGCGCGGCAAAGGACACCACA-----ACAACACAACACCUUUGGCCGCCUGCCUUCGUCCGAAG ((.((((((((((........-----...........))))).)))))))..((((....)))) ( -15.81, z-score = -1.56, R) >droYak2.chrX 19465303 64 - 21770863 AGCGCGGCAAAGGACACCACAACAACACAACACAACACCUUUGGCCGCCUGCUUUCCUCGGAAG (((((((((((((........................))))).)))))..)))(((....))). ( -15.06, z-score = -1.53, R) >droEre2.scaffold_4690 10308056 58 - 18748788 AGCGCGGCAAAGGACACCACA-----ACAACACAACACCUUU-GCCGGCUGCCUUCCUCCAAAG (((.(((((((((........-----...........)))))-))))))).............. ( -17.51, z-score = -3.37, R) >droSec1.super_8 2422382 59 - 3762037 AGCGCGGCAAAGGACACCACA-----ACAACACAACACCUUUGGCCGCCUGCCUUCGUCCGAAG ((.((((((((((........-----...........))))).)))))))..((((....)))) ( -15.81, z-score = -1.56, R) >consensus AGCGCGGCAAAGGACACCACA_____ACAACACAACACCUUUGGCCGCCUGCCUUCCUCCGAAG .((((((((((((........................))))).)))))..))((((....)))) (-12.75 = -13.06 + 0.31)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:03:27 2011