| Sequence ID | dm3.chrX |
|---|---|
| Location | 19,253,719 – 19,253,810 |
| Length | 91 |
| Max. P | 0.539697 |
| Location | 19,253,719 – 19,253,810 |
|---|---|
| Length | 91 |
| Sequences | 5 |
| Columns | 111 |
| Reading direction | reverse |
| Mean pairwise identity | 69.13 |
| Shannon entropy | 0.47970 |
| G+C content | 0.39335 |
| Mean single sequence MFE | -17.22 |
| Consensus MFE | -7.31 |
| Energy contribution | -7.43 |
| Covariance contribution | 0.12 |
| Combinations/Pair | 1.33 |
| Mean z-score | -1.78 |
| Structure conservation index | 0.42 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.09 |
| SVM RNA-class probability | 0.539697 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 19253719 91 - 22422827 -----------------AUCCUGCACGGAGAAACAGCGCUCUUGUGCUUUGCAGAUGCCA--UCUUACUUCAAAUGCUAUUCUGC-AGAUACAUUAUCUUCUUACCCUUAU -----------------.........(((((....((((....))))((((((((.((..--.............))...)))))-))).......))))).......... ( -19.36, z-score = -1.67, R) >droSim1.chrX 14878314 90 - 17042790 -----------------AUCCUGCACGAAGAAUCAGCACUCUUGUGCUUUGCAGAUGCCAUCUCUCACUUCAAAUGCUAUUCUGC-AGAUACAUUAUCUUACUCUUCU--- -----------------.........(((((....((((....))))((((((((.((.................))...)))))-))).............))))).--- ( -19.93, z-score = -2.27, R) >droSec1.super_8 1546386 90 - 3762037 -----------------AUCCUGCACGAAGAAUCAGCACUCUUGUGCUUUGCAGAUGCCAUCUCUCACUUCAAAUGCUAUUCUGC-AGAUACAUUAUCUUACCCUUCU--- -----------------.........((((.....((((....))))((((((((.((.................))...)))))-)))..............)))).--- ( -18.53, z-score = -2.02, R) >droYak2.chrX 9694570 100 + 21770863 AUCCUGCGCAAAACAAAAAAAAAAACAAAAAUACAGCACUUUUGUGCUUUUUAGAUGCCA--UCUUGCUGCAAAUGCUAUUCUGCAAGAUAUCUACCCUUCU--------- ..................................(((((....)))))...(((((...(--((((((.((....))......)))))))))))).......--------- ( -17.30, z-score = -1.46, R) >droEre2.scaffold_4690 9505544 82 - 18748788 -----------------AUGCUGCACAAAAA-ACAGCAUUUUUGUGCUUUUCCGAUGCCA--UCUUACUUCAAAUACUAUUCCUGCAGAUAUCUACCCUUUU--------- -----------------.(((.(((((((((-......)))))))))......(((...)--))....................)))...............--------- ( -11.00, z-score = -1.48, R) >consensus _________________AUCCUGCACGAAGAAACAGCACUCUUGUGCUUUGCAGAUGCCA__UCUUACUUCAAAUGCUAUUCUGC_AGAUACAUUAUCUUAU____CU___ ..................................(((((....)))))..(((((.((.................))...))))).......................... ( -7.31 = -7.43 + 0.12)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 02:00:11 2011