| Sequence ID | dm3.chrX |
|---|---|
| Location | 18,758,992 – 18,759,097 |
| Length | 105 |
| Max. P | 0.873826 |
| Location | 18,758,992 – 18,759,097 |
|---|---|
| Length | 105 |
| Sequences | 4 |
| Columns | 110 |
| Reading direction | reverse |
| Mean pairwise identity | 78.29 |
| Shannon entropy | 0.35359 |
| G+C content | 0.44773 |
| Mean single sequence MFE | -14.02 |
| Consensus MFE | -11.50 |
| Energy contribution | -11.75 |
| Covariance contribution | 0.25 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.39 |
| Structure conservation index | 0.82 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.01 |
| SVM RNA-class probability | 0.873826 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18758992 105 - 22422827 -CGCUCAAUU-UAAAAUCGUGUAAAAGGCGAAUUUCUCUUGAGCGUUCUUCUCUUCCUCUUUUCUCUCUC--GCUGUGU-UCCUCUCCUUCGGUUCUCCCCUUUCAAACU -(((((((..-.(((.((((.......)))).)))...))))))).........................--.....(.-.((........))..).............. ( -13.10, z-score = -1.17, R) >droAna3.scaffold_13047 169833 91 + 1816235 CCGCUCAAUUGAAAAAUCGUGUAAAAGGCGAAUUU-UGCUGAGCGUUC------------CCUCUCUCUC--GCUGCGUCUCCUCUCUUUCGUCGCGUUGUUCUCU---- .((((((....((((.((((.......)))).)))-)..))))))...------------.........(--((.(((............))).))).........---- ( -16.70, z-score = -0.65, R) >droEre2.scaffold_4690 9052061 105 - 18748788 -CGCUCAAUU-UAAAAUCGUGUAAAAGGCGAAUUUCUUUUGAGCGUUCUUCUCUCCCUUUUUACUCUCUC--ACUGUGU-UCCUCUCCUUCACUUCUCCCCUUUCUCUCU -(((((((..-.(((.((((.......)))).)))...))))))).........................--...(((.-..........)))................. ( -13.40, z-score = -2.78, R) >droSec1.super_8 1061741 107 - 3762037 -CGCUCAAUU-UAAAAUCGUGUAAAAGGCGAAUUUCUCUUGAGCGUUCUACUCUUCCUCUUUUCUCUCUCUGGCUGUGU-UCCUCUCCUUCGCUUCUCCCCUUUCUAACU -(((((((..-.(((.((((.......)))).)))...)))))))..........................((..(((.-..........)))....))........... ( -12.90, z-score = -0.97, R) >consensus _CGCUCAAUU_UAAAAUCGUGUAAAAGGCGAAUUUCUCUUGAGCGUUCUUCUCUUCCUCUUUUCUCUCUC__GCUGUGU_UCCUCUCCUUCGCUUCUCCCCUUUCUAACU .(((((((....(((.((((.......)))).)))...)))))))................................................................. (-11.50 = -11.75 + 0.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:58:12 2011