| Sequence ID | dm3.chrX |
|---|---|
| Location | 18,577,146 – 18,577,196 |
| Length | 50 |
| Max. P | 0.808687 |
| Location | 18,577,146 – 18,577,196 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 50 |
| Reading direction | forward |
| Mean pairwise identity | 100.00 |
| Shannon entropy | -0.00000 |
| G+C content | 0.62000 |
| Mean single sequence MFE | -18.60 |
| Consensus MFE | -18.60 |
| Energy contribution | -18.60 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.29 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.76 |
| SVM RNA-class probability | 0.808687 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18577146 50 + 22422827 AAAUCGCUGACUCUGGGUGAAAGAGCAGACGAGGGCCUGGCCAGCUGGGC ...((((((.((((.......))))))).)))..(((..(....)..))) ( -18.60, z-score = -1.29, R) >droSim1.chrX_random 4817667 50 + 5698898 AAAUCGCUGACUCUGGGUGAAAGAGCAGACGAGGGCCUGGCCAGCUGGGC ...((((((.((((.......))))))).)))..(((..(....)..))) ( -18.60, z-score = -1.29, R) >droSec1.super_8 880576 50 + 3762037 AAAUCGCUGACUCUGGGUGAAAGAGCAGACGAGGGCCUGGCCAGCUGGGC ...((((((.((((.......))))))).)))..(((..(....)..))) ( -18.60, z-score = -1.29, R) >consensus AAAUCGCUGACUCUGGGUGAAAGAGCAGACGAGGGCCUGGCCAGCUGGGC ...((((((.((((.......))))))).)))..(((..(....)..))) (-18.60 = -18.60 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:57:42 2011