| Sequence ID | dm3.chrX |
|---|---|
| Location | 18,442,522 – 18,442,594 |
| Length | 72 |
| Max. P | 0.854419 |
| Location | 18,442,522 – 18,442,594 |
|---|---|
| Length | 72 |
| Sequences | 4 |
| Columns | 72 |
| Reading direction | forward |
| Mean pairwise identity | 66.51 |
| Shannon entropy | 0.53758 |
| G+C content | 0.45607 |
| Mean single sequence MFE | -21.93 |
| Consensus MFE | -12.35 |
| Energy contribution | -11.23 |
| Covariance contribution | -1.13 |
| Combinations/Pair | 1.56 |
| Mean z-score | -1.22 |
| Structure conservation index | 0.56 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.81 |
| SVM RNA-class probability | 0.823541 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18442522 72 + 22422827 GUUGGCUUGGAUGCACAGAGUAUGAACAUAUACAUAUGUACAUAUGUACGAAUGUAUGAGGUGGAGUCAUGU ..((((((.(((((.....))))...(.(((((((.(((((....))))).))))))).).).))))))... ( -18.30, z-score = -0.88, R) >droSim1.chrX 14238348 66 + 17042790 GUUGGCUUGGAUGC-CACAGUAUGUACAUACACACGAGUGUGUGUGUGUG-----AGGAGGAGUCGUCAUGU ..((((...(((.(-(.(..((..(((((((((....)))))))))..))-----..).)).)))))))... ( -22.20, z-score = -1.19, R) >droSec1.super_8 748514 69 + 3762037 GUUGGCUUGGAUGCACACAGUAUGUACAUACACACGAGUGUGUGUGUGUGUG---AGGAGGAGUCGUCAUGU (.((((((.....((((((.....(((((((((....)))))))))))))))---.....)))))).).... ( -23.10, z-score = -0.82, R) >droEre2.scaffold_4690 8758320 61 + 18748788 GUUGGCUUCAAUGCACACAGUGCAUAUGCACAUAUGCACAUGUGUAUGUG-----AGAAGGCAUGU------ ..((.((((.((..(((((((((((((....)))))))).)))))..)).-----.)))).))...------ ( -24.10, z-score = -1.98, R) >consensus GUUGGCUUGGAUGCACACAGUAUGUACAUACACACGAGUAUGUGUGUGUG_____AGGAGGAGUCGUCAUGU ..((((......)).)).....((((((((((((....))))))))))))...................... (-12.35 = -11.23 + -1.13)
| Location | 18,442,522 – 18,442,594 |
|---|---|
| Length | 72 |
| Sequences | 4 |
| Columns | 72 |
| Reading direction | reverse |
| Mean pairwise identity | 66.51 |
| Shannon entropy | 0.53758 |
| G+C content | 0.45607 |
| Mean single sequence MFE | -15.43 |
| Consensus MFE | -9.06 |
| Energy contribution | -8.12 |
| Covariance contribution | -0.94 |
| Combinations/Pair | 1.54 |
| Mean z-score | -1.17 |
| Structure conservation index | 0.59 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.93 |
| SVM RNA-class probability | 0.854419 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18442522 72 - 22422827 ACAUGACUCCACCUCAUACAUUCGUACAUAUGUACAUAUGUAUAUGUUCAUACUCUGUGCAUCCAAGCCAAC ..((((.......))))......(((((((((.(((((....))))).))))...)))))............ ( -10.80, z-score = -0.59, R) >droSim1.chrX 14238348 66 - 17042790 ACAUGACGACUCCUCCU-----CACACACACACACUCGUGUGUAUGUACAUACUGUG-GCAUCCAAGCCAAC .................-----.(((.((((((....)))))).)))........((-((......)))).. ( -15.20, z-score = -1.30, R) >droSec1.super_8 748514 69 - 3762037 ACAUGACGACUCCUCCU---CACACACACACACACUCGUGUGUAUGUACAUACUGUGUGCAUCCAAGCCAAC ...(((.((....)).)---))...((((((......))))))((((((((...)))))))).......... ( -14.10, z-score = -0.44, R) >droEre2.scaffold_4690 8758320 61 - 18748788 ------ACAUGCCUUCU-----CACAUACACAUGUGCAUAUGUGCAUAUGCACUGUGUGCAUUGAAGCCAAC ------...((.((((.-----....((((((.((((((((....))))))))))))))....)))).)).. ( -21.60, z-score = -2.34, R) >consensus ACAUGACGACUCCUCCU_____CACACACACACACUCAUGUGUAUGUACAUACUGUGUGCAUCCAAGCCAAC .........................(((((((((....)))))))))........((.((......)))).. ( -9.06 = -8.12 + -0.94)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:57:14 2011