| Sequence ID | dm3.chrX |
|---|---|
| Location | 18,236,518 – 18,236,578 |
| Length | 60 |
| Max. P | 0.515895 |
| Location | 18,236,518 – 18,236,578 |
|---|---|
| Length | 60 |
| Sequences | 7 |
| Columns | 60 |
| Reading direction | reverse |
| Mean pairwise identity | 68.43 |
| Shannon entropy | 0.61413 |
| G+C content | 0.58033 |
| Mean single sequence MFE | -17.03 |
| Consensus MFE | -8.86 |
| Energy contribution | -9.03 |
| Covariance contribution | 0.17 |
| Combinations/Pair | 1.59 |
| Mean z-score | -0.64 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.04 |
| SVM RNA-class probability | 0.515895 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18236518 60 - 22422827 GCCAAAAUCCUGCUGGCGCUUUUGGCCAUACGCCUGUCAAGGUCCAAGGCCCAAAUGCCG ((((.........))))(((((.((((....((((....))))....)))).))).)).. ( -18.80, z-score = -1.08, R) >droEre2.scaffold_4690 8559899 60 - 18748788 GCCGAAAUCCUGCUGGCGCUUUUGGCCGUCCGCCUGUCAAGGCCCAGUGCCCAAAUGCCG ((.(.....).)).((((.(((.((((....((((....))))...).))).))))))). ( -17.40, z-score = -0.27, R) >droYak2.chrX 16870275 57 - 21770863 GCUGAAAUCAUGCUGGCGCUUUUGGCCAUUCGCCUGUCAAGGUU---CGCCCAAAUGUCG ((((....)).)).((((.(((.(((.....((((....)))).---.))).))))))). ( -12.90, z-score = 0.33, R) >droSec1.super_8 548718 57 - 3762037 GCCGAAAUCCUGCUGGCGCUUUUGGCCAUUCGCCUGUCAAGGUU---GGCCCAAAUGCCG ((.(.....).)).((((.(((.(((((...((((....)))))---)))).))))))). ( -19.80, z-score = -1.37, R) >droSim1.chrX 14057022 57 - 17042790 GCCGAAAUCCUGCUGGCGCUUUUGGCCAUUCGCCUGUCAAGGUU---GGCCCAAAUGCCG ((.(.....).)).((((.(((.(((((...((((....)))))---)))).))))))). ( -19.80, z-score = -1.37, R) >droMoj3.scaffold_6473 3820904 60 - 16943266 GCCAAUGUCAAUUUGGCUUUCUAGACGCUCGCCCCGCUGAGAUGCUGUGCCUCAACGGCG (((((.......)))))..........(((((...)).)))..(((((......))))). ( -15.00, z-score = -0.15, R) >droVir3.scaffold_12970 3006936 57 - 11907090 GCCAAUGUCAAUUUGGCUUUCUAGCAGCUU---UGGACGAGAUGCUGUAUGCCAACGGCG ((((((....)))((((....(((((.(((---.....))).)))))...))))..))). ( -15.50, z-score = -0.56, R) >consensus GCCGAAAUCCUGCUGGCGCUUUUGGCCAUUCGCCUGUCAAGGUUC__GGCCCAAAUGCCG ((((.........))))((.(((((((....((((....))))....)).))))).)).. ( -8.86 = -9.03 + 0.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:56:17 2011