| Sequence ID | dm3.chrX |
|---|---|
| Location | 18,092,451 – 18,092,533 |
| Length | 82 |
| Max. P | 0.938718 |
| Location | 18,092,451 – 18,092,533 |
|---|---|
| Length | 82 |
| Sequences | 6 |
| Columns | 85 |
| Reading direction | forward |
| Mean pairwise identity | 72.37 |
| Shannon entropy | 0.52103 |
| G+C content | 0.30996 |
| Mean single sequence MFE | -16.13 |
| Consensus MFE | -12.75 |
| Energy contribution | -10.40 |
| Covariance contribution | -2.35 |
| Combinations/Pair | 1.96 |
| Mean z-score | -1.03 |
| Structure conservation index | 0.79 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.45 |
| SVM RNA-class probability | 0.938718 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18092451 82 + 22422827 --CAUUUAAUUAUGCAUAUUUAUUAAAACUUUAAGCGGUUCACAGCCGCUUUGG-CGUAUCUAUUAGAUAACCAAAUAGUUAAAU --.((((((((((....................((((((.....))))))((((-..((((.....)))).)))))))))))))) ( -19.10, z-score = -3.00, R) >droSim1.chrX_random 194539 82 + 5698898 --CAUUUAAUUAUGCAUAUUUAUUUAAGCUUUAAGCGGUUCACAGCCGCUUUGU-UGUAUCUAUUAGAUAGCCAAAUAGUUAAAU --.((((((((((((.((((((....(((...(((((((.....))))))).))-)........))))))))...)))))))))) ( -19.30, z-score = -2.39, R) >droSec1.super_8 404588 82 + 3762037 --CAUUUAAUUAUGCAUAUUUAUUAAAGCUUUAAGUGGUUCACAGCCGCUUUGU-UGUAUCUAUUAGAUAGCCAAAUAGUUAAAU --.((((((((((((.((((((.((.(((...(((((((.....))))))).))-).....)).))))))))...)))))))))) ( -17.50, z-score = -1.98, R) >droYak2.chrX 16719684 82 + 21770863 --CAUUUAAUUAUGCAUAUUUACUAAAGCUUUAAGCGACUCACUGCUGCUUUGU-UGCAUCUAUUAGAUAGCCAAAUAGUUAGAU --.((((((((((((.((((((.((..((...(((((.(.....).)))))...-.))...)).))))))))...)))))))))) ( -14.10, z-score = 0.04, R) >droEre2.scaffold_4690 8423108 81 + 18748788 --CAUUUGAUUAUGCCUGUUUAUUAAAGCUCUAAGCGAUUCACUGC-GCGUUGU-UGUAUCUAUCAGAUAGCCAAAUAGCUCUGU --.(((((((.((((..((((....)))).....(((........)-)).....-.))))..)))))))(((......))).... ( -11.50, z-score = 1.34, R) >droVir3.scaffold_13246 1757345 85 - 2672878 UAAGCUUUAGUGUGAAAAACUGCAAAGAUUUUUGAUUUGAAAUUUAAGUUUCGGGCGCAUUUUCCAGUUUUUCAAAUGUUGAAAU .....(((((..((((((((((..(((((...((.((((((((....)))))))))).))))).)))))))))..)..))))).. ( -15.30, z-score = -0.17, R) >consensus __CAUUUAAUUAUGCAUAUUUAUUAAAGCUUUAAGCGGUUCACAGCCGCUUUGU_UGUAUCUAUUAGAUAGCCAAAUAGUUAAAU ...((((((((((...((((((.....((...(((((((.....))))))).....))......)))))).....)))))))))) (-12.75 = -10.40 + -2.35)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:55:34 2011