Sequence ID | dm3.chrX |
---|---|
Location | 18,012,492 – 18,012,558 |
Length | 66 |
Max. P | 0.972180 |
Location | 18,012,492 – 18,012,558 |
---|---|
Length | 66 |
Sequences | 4 |
Columns | 70 |
Reading direction | forward |
Mean pairwise identity | 88.94 |
Shannon entropy | 0.17034 |
G+C content | 0.31978 |
Mean single sequence MFE | -17.51 |
Consensus MFE | -12.60 |
Energy contribution | -12.72 |
Covariance contribution | 0.12 |
Combinations/Pair | 1.21 |
Mean z-score | -3.04 |
Structure conservation index | 0.72 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.86 |
SVM RNA-class probability | 0.972180 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18012492 66 + 22422827 UCUAUAAACUUUCAGCAGGGAGAGCAACAACAAAAUAUUGUUGAAAAUAAUGUUGCUUUU----CCCUGC ..............(((((((((((((((((((....)))).........)))))).)))----)))))) ( -21.80, z-score = -4.79, R) >droEre2.scaffold_4690 8340459 69 + 18748788 UCUAUAAACUUUCAGCAGG-AAAGCAAAAACAAAAUAUUGUUGAAAAUAAUGUUGCUUUUGCUAUUCUGC ..............(((((-(.(((((((....((((((((.....))))))))..))))))).)))))) ( -18.30, z-score = -2.94, R) >droYak2.chrX 16636611 65 + 21770863 UCUAUAAACUUUUUGCAGG-AAAGCAGCAACAAAAUAUUGUUGAAAAUAAUGUUCCUUUU----CUUUGC ................(((-((.....((((((....)))))).........)))))...----...... ( -8.14, z-score = 0.38, R) >droSec1.super_8 317731 66 + 3762037 UCUAUAAACUUUCAGCAGGGAGAGCAACAACAAAAUAUUGUUGAAAAUAAUGUUGCUUUU----CCCUGC ..............(((((((((((((((((((....)))).........)))))).)))----)))))) ( -21.80, z-score = -4.79, R) >consensus UCUAUAAACUUUCAGCAGG_AAAGCAACAACAAAAUAUUGUUGAAAAUAAUGUUGCUUUU____CCCUGC ..............(((((((((((((((((((....)))).........))))))))).....)))))) (-12.60 = -12.72 + 0.12)
Location | 18,012,492 – 18,012,558 |
---|---|
Length | 66 |
Sequences | 4 |
Columns | 70 |
Reading direction | reverse |
Mean pairwise identity | 88.94 |
Shannon entropy | 0.17034 |
G+C content | 0.31978 |
Mean single sequence MFE | -17.65 |
Consensus MFE | -10.34 |
Energy contribution | -11.90 |
Covariance contribution | 1.56 |
Combinations/Pair | 1.06 |
Mean z-score | -2.72 |
Structure conservation index | 0.59 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.42 |
SVM RNA-class probability | 0.687641 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 18012492 66 - 22422827 GCAGGG----AAAAGCAACAUUAUUUUCAACAAUAUUUUGUUGUUGCUCUCCCUGCUGAAAGUUUAUAGA ((((((----(..(((((((.........((((....))))))))))).))))))).............. ( -21.70, z-score = -4.25, R) >droEre2.scaffold_4690 8340459 69 - 18748788 GCAGAAUAGCAAAAGCAACAUUAUUUUCAACAAUAUUUUGUUUUUGCUUU-CCUGCUGAAAGUUUAUAGA ((((...(((((((((((...((((......))))..)))))))))))..-.)))).............. ( -18.20, z-score = -2.68, R) >droYak2.chrX 16636611 65 - 21770863 GCAAAG----AAAAGGAACAUUAUUUUCAACAAUAUUUUGUUGCUGCUUU-CCUGCAAAAAGUUUAUAGA ......----.....((((........((((((....)))))).(((...-...)))....))))..... ( -9.00, z-score = 0.29, R) >droSec1.super_8 317731 66 - 3762037 GCAGGG----AAAAGCAACAUUAUUUUCAACAAUAUUUUGUUGUUGCUCUCCCUGCUGAAAGUUUAUAGA ((((((----(..(((((((.........((((....))))))))))).))))))).............. ( -21.70, z-score = -4.25, R) >consensus GCAGAG____AAAAGCAACAUUAUUUUCAACAAUAUUUUGUUGUUGCUCU_CCUGCUGAAAGUUUAUAGA ((((((.......(((((((.((((......))))...))))))).....)))))).............. (-10.34 = -11.90 + 1.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:55:09 2011