| Sequence ID | dm3.chr2L |
|---|---|
| Location | 11,749,808 – 11,749,876 |
| Length | 68 |
| Max. P | 0.500000 |
| Location | 11,749,808 – 11,749,876 |
|---|---|
| Length | 68 |
| Sequences | 9 |
| Columns | 75 |
| Reading direction | reverse |
| Mean pairwise identity | 84.23 |
| Shannon entropy | 0.32181 |
| G+C content | 0.39827 |
| Mean single sequence MFE | -20.51 |
| Consensus MFE | -13.55 |
| Energy contribution | -13.88 |
| Covariance contribution | 0.33 |
| Combinations/Pair | 1.33 |
| Mean z-score | -1.55 |
| Structure conservation index | 0.66 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.02 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 11749808 68 - 23011544 -----UUAACGCUUUAAGCAGUCAUUGCAUUUA-AUGGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUUAGCGU -----..(((.(((.((((((((((((....))-)))))))))).)))))).....((-(((.....).)))).. ( -21.90, z-score = -2.41, R) >droPer1.super_1 4096054 68 - 10282868 -----UCAACGCUUUAAGCAGUCGUUGCGUUUA-AUUGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUAAGCGU -----...((((((...(((((((..(((.(((-((.(((.......)))..))))).-)))))))))))))))) ( -17.50, z-score = -0.35, R) >dp4.chr4_group3 2621426 68 - 11692001 -----UCAACGCUUUAAGCAGUCGUUGCGUUUA-AUUGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUAAGCGU -----...((((((...(((((((..(((.(((-((.(((.......)))..))))).-)))))))))))))))) ( -17.50, z-score = -0.35, R) >droAna3.scaffold_12916 9457395 68 + 16180835 -----UUUACGCUUUAAGCAGUAGUUGCGUUUA-AUUGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUCAGCAU -----.....(((((((((((((((((....))-)))))))).)))))))........-(((((.....))))). ( -22.60, z-score = -2.59, R) >droEre2.scaffold_4929 12974108 68 + 26641161 -----UUAACGCUUUAAGCAGUCAUUGCACUUA-AUGGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUAAGCGU -----..(((.(((.((((((((((((....))-)))))))))).)))))).....((-(((.....)).))).. ( -21.90, z-score = -2.19, R) >droYak2.chr2L 8169328 68 - 22324452 -----UUAACGCUUUAAGCAGUCAUUGCAUUUA-AUGGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUAAGCGU -----..(((.(((.((((((((((((....))-)))))))))).)))))).....((-(((.....)).))).. ( -21.90, z-score = -2.38, R) >droSec1.super_3 7139483 68 - 7220098 -----UUAACGCUUUAAGCAGUCAUUGCAUUUA-AUGGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUUAGCGU -----..(((.(((.((((((((((((....))-)))))))))).)))))).....((-(((.....).)))).. ( -21.90, z-score = -2.41, R) >droSim1.chr2L 11559927 68 - 22036055 -----UUAACGCUUUAAGCAGUCAUUGCAUUUA-AUGGCUGCUUUGAGGUUUAUUAGC-UGCUGAUUGUUAGCGU -----..(((.(((.((((((((((((....))-)))))))))).)))))).....((-(((.....).)))).. ( -21.90, z-score = -2.41, R) >anoGam1.chr2R 44227185 73 - 62725911 UGCGGUUAGUG--UUAAUCGCUGCAUGCAUAUGCAUAUGUGCCCUGUGUUUUGCUAUCGGGUCGAUUAUUGGCAU .(((((((...--.)))))))(((((((....))))....((((.(((......))).)))).........))). ( -17.50, z-score = 1.11, R) >consensus _____UUAACGCUUUAAGCAGUCAUUGCAUUUA_AUGGCUGCUUUGAGGUUUAUUAGC_UGCUGAUUGUAAGCGU ..........(((((((((((((((.........)))))))).)))))))..........(((.......))).. (-13.55 = -13.88 + 0.33)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:33:32 2011