Sequence ID | dm3.chr2L |
---|---|
Location | 1,047,047 – 1,047,105 |
Length | 58 |
Max. P | 0.967634 |
Location | 1,047,047 – 1,047,105 |
---|---|
Length | 58 |
Sequences | 5 |
Columns | 62 |
Reading direction | forward |
Mean pairwise identity | 89.26 |
Shannon entropy | 0.17908 |
G+C content | 0.35006 |
Mean single sequence MFE | -19.82 |
Consensus MFE | -15.82 |
Energy contribution | -15.26 |
Covariance contribution | -0.56 |
Combinations/Pair | 1.18 |
Mean z-score | -2.62 |
Structure conservation index | 0.80 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.79 |
SVM RNA-class probability | 0.967634 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 1047047 58 + 23011544 UUCGCCCGUGUGUACAUAAUAUGUACAUAUAUGUAUAU----UAUAUGUGUAUAUAGUGAGU (((((..(((....)))..((((((((((((((.....----))))))))))))))))))). ( -17.10, z-score = -2.27, R) >droSim1.chr2L 1017703 58 + 22036055 UUCGCCCGUGUGUACAUAAUAUGUACAUCUAUGUAUAU----UAUAUGUGUAUAUAGUGGGU ...(((((((((((((((..(((((((....)))))))----....)))))))))).))))) ( -20.80, z-score = -3.25, R) >droSec1.super_14 1000536 58 + 2068291 UUCGCCCGUGUGUACAUAAUAUGUACAUCUAUGUAUAU----UAUAUGUGUAUAUAGCGGGU ...(((((((((((((((..(((((((....)))))))----....)))))))))).))))) ( -22.60, z-score = -3.77, R) >droEre2.scaffold_4929 1088762 58 + 26641161 UUCGCCCGUGUGUACAUAACGCGUACAUAUAUGUGUGU----UCUAUGUGUAUAUAGUGGGU ...((((((((((((((((((((((....)))))))..----....)))))))))).))))) ( -20.00, z-score = -2.22, R) >droYak2.chr2L 1022843 62 + 22324452 UUCGCCCGUGUGUACAUAACGUGUACAUAUAUGUGUAUGUUCUAUAUGUGUAUAUAGUGGCU ...(((..((((((((((....(.((((((....)))))).)....))))))))))..))). ( -18.60, z-score = -1.61, R) >consensus UUCGCCCGUGUGUACAUAAUAUGUACAUAUAUGUAUAU____UAUAUGUGUAUAUAGUGGGU ...(((((((((((((((..(((((((....)))))))........)))))))))).))))) (-15.82 = -15.26 + -0.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:07:38 2011