| Sequence ID | dm3.chrX |
|---|---|
| Location | 17,890,475 – 17,890,570 |
| Length | 95 |
| Max. P | 0.968088 |
| Location | 17,890,475 – 17,890,570 |
|---|---|
| Length | 95 |
| Sequences | 5 |
| Columns | 95 |
| Reading direction | reverse |
| Mean pairwise identity | 69.16 |
| Shannon entropy | 0.55986 |
| G+C content | 0.27895 |
| Mean single sequence MFE | -21.22 |
| Consensus MFE | -9.12 |
| Energy contribution | -11.68 |
| Covariance contribution | 2.56 |
| Combinations/Pair | 1.22 |
| Mean z-score | -2.20 |
| Structure conservation index | 0.43 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.79 |
| SVM RNA-class probability | 0.968088 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 17890475 95 - 22422827 UAGUUUUGUGUGCAGAAAUAGUUGUGAUUUAUUAUUUUAAUUGCUGAAACAUAGAAUAAAUAAAUGGAUUAUUUAUUGUAUGUGUGCACUAAGCU .(((((.(((..(.((((((((........))))))))..........(((((.(((((((((.....))))))))).))))))..))).))))) ( -24.90, z-score = -3.46, R) >droEre2.scaffold_4690 8218187 95 - 18748788 UAGUUUUGUGUGCAGAUAUAGUUGUGAAUUAUUAUUUAAGCCGCUGAAACAUAGAAUAAAUAUAUUUAUUGUUUAUUGUAUGUGGGCACUAAGCA ..((((.((((.((.(((((((.(((..(((.....)))..)))..(((((..(((((....)))))..)))))))))))).)).)))).)))). ( -22.60, z-score = -1.80, R) >droYak2.chrX 16509474 95 - 21770863 UAGUUUUGUGUGCAGAUAUAAUUGUGAUUUAUUAUUUUAAAUGCUGAAACAUAGAAUAAAUGUAUGGAUUAUUUAUUGUAUGUGUGCACUAAGCU .(((((.(((..((.(((((((.((((((((((((((...(((......))).....))))).)))))))))..))))))).))..))).))))) ( -25.50, z-score = -3.47, R) >droSim1.chrX_random 4590654 95 - 5698898 UAGUUUUGUGUGCAGAAAUAGUUGUGAUUUAUUAUUUUAAUUGCUGAAACAUAGAAUAAAUAAAAGGAUUAUUUAUUGUAUGCGUGCACUAAGCU .(((((.(((..(.((((((((........))))))))...........((((.(((((((((.....))))))))).)))).)..))).))))) ( -23.40, z-score = -2.68, R) >droVir3.scaffold_12823 1714869 76 + 2474545 ------UCGACUUAAAUAUAU---CGAGUAAUCGUUUUGGUAACUUAUCGAUAGAAGAACU-UAAGGUCCACCUCCAAAUCAAGUU--------- ------..(((((.....(((---(((((.(((.....))).))...))))))...((...-..(((....))).....)))))))--------- ( -9.70, z-score = 0.42, R) >consensus UAGUUUUGUGUGCAGAUAUAGUUGUGAUUUAUUAUUUUAAUUGCUGAAACAUAGAAUAAAUAUAUGGAUUAUUUAUUGUAUGUGUGCACUAAGCU ..((((.((((((..........((((....)))).............(((((.((((((((.......)))))))).))))))))))).)))). ( -9.12 = -11.68 + 2.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:54:46 2011