| Sequence ID | dm3.chrX |
|---|---|
| Location | 17,584,836 – 17,584,886 |
| Length | 50 |
| Max. P | 0.747283 |
| Location | 17,584,836 – 17,584,886 |
|---|---|
| Length | 50 |
| Sequences | 5 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 94.44 |
| Shannon entropy | 0.09909 |
| G+C content | 0.48204 |
| Mean single sequence MFE | -16.00 |
| Consensus MFE | -12.20 |
| Energy contribution | -11.92 |
| Covariance contribution | -0.28 |
| Combinations/Pair | 1.30 |
| Mean z-score | -2.39 |
| Structure conservation index | 0.76 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.57 |
| SVM RNA-class probability | 0.747283 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 17584836 50 - 22422827 UCUUUGGGUCCAGCUAAUUCAAAGUGGGCCCA-AAAGUUUGUUUUGCGUCC ..((((((((((.((.......))))))))))-))................ ( -15.40, z-score = -2.61, R) >droEre2.scaffold_4690 7920528 50 - 18748788 UCUGUGGGUCCAGCUAAUUCAAGCUGGGCCCG-AAAGUUUGUUUUGCGCCC ....(((((((((((......)))))))))))-.................. ( -20.60, z-score = -3.21, R) >droYak2.chrX 16212764 51 - 21770863 UCUUUGGGUCCGGCUAAUUCAAAGUGGGCCCACAAAGUUUGUUUUGCGUCC ....((((((((.((.......))))))))))(((((....)))))..... ( -13.20, z-score = -0.92, R) >droSec1.super_17 1430819 50 - 1527944 UCUUUGGGUCCAGCUAAUUCAAAGUGGGCCCA-AAAGUUUGUUUUGCGUCC ..((((((((((.((.......))))))))))-))................ ( -15.40, z-score = -2.61, R) >droSim1.chrX_random 4521013 50 - 5698898 UCUUUGGGUCCAGCUAAUUCAAAGUGGGCCCA-AAAGUUUGUUUUGCGUCC ..((((((((((.((.......))))))))))-))................ ( -15.40, z-score = -2.61, R) >consensus UCUUUGGGUCCAGCUAAUUCAAAGUGGGCCCA_AAAGUUUGUUUUGCGUCC ....((((((((.((.......))))))))))................... (-12.20 = -11.92 + -0.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:53:48 2011