Sequence ID | dm3.chrX |
---|---|
Location | 17,418,450 – 17,418,504 |
Length | 54 |
Max. P | 0.974824 |
Location | 17,418,450 – 17,418,504 |
---|---|
Length | 54 |
Sequences | 5 |
Columns | 54 |
Reading direction | forward |
Mean pairwise identity | 94.44 |
Shannon entropy | 0.09819 |
G+C content | 0.49811 |
Mean single sequence MFE | -10.54 |
Consensus MFE | -9.04 |
Energy contribution | -9.64 |
Covariance contribution | 0.60 |
Combinations/Pair | 1.00 |
Mean z-score | -2.74 |
Structure conservation index | 0.86 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.92 |
SVM RNA-class probability | 0.974824 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 17418450 54 + 22422827 GCGUGCAACUUGCCACCACAAGAAAAAUCAACUUCGAUGCACAUACCCACUCGA ..((((..((((......))))....(((......)))))))............ ( -9.30, z-score = -2.41, R) >droEre2.scaffold_4690 7757555 54 + 18748788 ACGUGCAACUUGCCACCACAAGAAAAAUCGACUGCGAUGCACAUACCCACUCGA ..((((..((((......))))....((((....))))))))............ ( -11.30, z-score = -2.88, R) >droYak2.chrX 16046787 53 + 21770863 ACGUGCAACUUGCCACCACAAGAAAAAUCGACUUCGCUGCAC-UACCCACUAGA ..(((((.((((......))))......((....)).)))))-........... ( -8.90, z-score = -2.02, R) >droSec1.super_17 1263784 54 + 1527944 GCGUGCAACUUGCCACCACAAGAAAAAUCGACUUCGACGCACAUACCCACUCGA ..((((..((((......)))).....(((....))).))))............ ( -11.10, z-score = -3.01, R) >droSim1.chrX 3544367 54 - 17042790 GCGUGCAACUUGCCACCACAAGAAAAAUCGACUUCGAUGCACAUACCCACUCGA ..((((..((((......))))....((((....))))))))............ ( -12.10, z-score = -3.39, R) >consensus GCGUGCAACUUGCCACCACAAGAAAAAUCGACUUCGAUGCACAUACCCACUCGA ..((((..((((......))))....((((....))))))))............ ( -9.04 = -9.64 + 0.60)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:53:07 2011