| Sequence ID | dm3.chrX |
|---|---|
| Location | 17,399,646 – 17,399,749 |
| Length | 103 |
| Max. P | 0.884631 |
| Location | 17,399,646 – 17,399,749 |
|---|---|
| Length | 103 |
| Sequences | 4 |
| Columns | 110 |
| Reading direction | forward |
| Mean pairwise identity | 79.01 |
| Shannon entropy | 0.33053 |
| G+C content | 0.29709 |
| Mean single sequence MFE | -23.45 |
| Consensus MFE | -15.15 |
| Energy contribution | -16.90 |
| Covariance contribution | 1.75 |
| Combinations/Pair | 1.19 |
| Mean z-score | -2.08 |
| Structure conservation index | 0.65 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.07 |
| SVM RNA-class probability | 0.884631 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 17399646 103 + 22422827 AUUGCCUUUUUUU---GGUG-UUUUUUUUGCUGUAAAUUAAUAUACCCUUGAAGUGGGUAUAACUUUAAGGUAAACGCUUGAAAAUAGGUUCACAACUAUUCUUUUU--- ...(((((((((.---((((-(((.(((((..((.......(((((((.......)))))))))..))))).))))))).))))).)))).................--- ( -22.71, z-score = -2.14, R) >droEre2.scaffold_4690 7739028 105 + 18748788 AUUGCUUUUAUUU---GGCGAGUUUUU--GCUGUACAUUAAAAUACCCUUGAAAUGGGUAUAAUUUUAUUGUGCACGUUUAAAAAUAGAUCCAUCAUAGCUAUUCUACUU ...(((......(---((...((((((--((((((((.((((((((((.......))))))...)))).)))))).))..))))))....)))....))).......... ( -22.10, z-score = -2.00, R) >droYak2.chrX 16027971 105 + 21770863 AUUGCUUUUAUUU---GGUGGGUUUUU--GCUGUACAUUAAUAUACCCUUGAAGUGGGCAUAACUUUAAUGUGCACGCUUGAAAAUAGAUCCAUCAUAGCUAUUCUAUUU ...(((......(---(((((((((..--(((((((((((((((.(((.......))).)))...)))))))))).))........)))))))))).))).......... ( -28.00, z-score = -2.78, R) >droSec1.super_17 1245498 108 + 1527944 AUUGCCUUUUUUUUUUGGUGAUUUUUUUUGCUGUUUAUUAAUAUACCCUUGAAGUGGGUAUAACUUUAAGGUAAACGCUUGAAAAUAGGUUCA-AACCAUUAUUAUUUU- ((..((..........))..))(((((..((.(((((((..(((((((.......))))))).......)))))))))..)))))..(((...-.)))...........- ( -21.00, z-score = -1.38, R) >consensus AUUGCCUUUAUUU___GGUGAGUUUUU__GCUGUACAUUAAUAUACCCUUGAAGUGGGUAUAACUUUAAGGUAAACGCUUGAAAAUAGAUCCAUAACAACUAUUCUAUU_ ................((...((((((..(((((((((((((((((((.......)))))))...)))))))))).))..))))))....)).................. (-15.15 = -16.90 + 1.75)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:53:03 2011