| Sequence ID | dm3.chrX |
|---|---|
| Location | 17,372,961 – 17,373,039 |
| Length | 78 |
| Max. P | 0.628159 |
| Location | 17,372,961 – 17,373,039 |
|---|---|
| Length | 78 |
| Sequences | 5 |
| Columns | 85 |
| Reading direction | forward |
| Mean pairwise identity | 68.94 |
| Shannon entropy | 0.53878 |
| G+C content | 0.29987 |
| Mean single sequence MFE | -14.58 |
| Consensus MFE | -7.48 |
| Energy contribution | -7.56 |
| Covariance contribution | 0.08 |
| Combinations/Pair | 1.56 |
| Mean z-score | -1.16 |
| Structure conservation index | 0.51 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.28 |
| SVM RNA-class probability | 0.628159 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 17372961 78 + 22422827 ------UAAACCUUUAUUAAUGGCCUCAUGGGAAUUGGGUCAAUUGAAAAUGUUU-GAAUAAAUUUCAAAAUUUAUUACACUAAU ------(((((.(((.((((((((((.((....)).))))).)))))))).))))-)((((((((....))))))))........ ( -12.70, z-score = -0.83, R) >droEre2.scaffold_4690 7713019 72 + 18748788 ------UAAACAUUCAUUAAUGGCUUCAUGGGAAAUGGGUCAAUUGAAAAUGUUU-GAAUAAAUUCCAAAACUUCCAAA------ ------((((((((..(((((((((.(((.....))))))).))))).)))))))-)......................------ ( -11.20, z-score = -0.19, R) >droSec1.super_17 1218856 78 + 1527944 ------UAAACAUUUAUCAAUGGCCCCAUGGGAAAUGGGUCAAUUGAAAAUGUUU-GAAUAAAUUCCAAAAUUUAUUACACUAAU ------(((((((((.((((((((((.((.....))))))).)))))))))))))-)((((((((....))))))))........ ( -20.30, z-score = -2.70, R) >droSim1.chrX 3498857 78 - 17042790 ------UAAACAUUUAUUAAUGGCCCCAUGGGAAAUGGGUCAAUUGAAAAUGUUU-GAAUAAAUUCCAAAAUUUAUUACACUAAU ------(((((((((.((((((((((.((.....))))))).)))))))))))))-)((((((((....))))))))........ ( -18.10, z-score = -1.96, R) >dp4.chrXL_group1a 8880316 85 + 9151740 UAAAAGUGAACGCAUAUCUCCAGAGGUUAAAGCCAUGUUCCAGGUCCCAAUCUUUCGACCAAAAUCGAAAACAGAGCAAAACAAA ........................(((....))).(((((..(....)....((((((......))))))...)))))....... ( -10.60, z-score = -0.12, R) >consensus ______UAAACAUUUAUUAAUGGCCCCAUGGGAAAUGGGUCAAUUGAAAAUGUUU_GAAUAAAUUCCAAAAUUUAUUACACUAAU .......((((((((.((((((((((..........))))).))))))))))))).............................. ( -7.48 = -7.56 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:52:52 2011