| Sequence ID | dm3.chrX |
|---|---|
| Location | 16,962,789 – 16,962,883 |
| Length | 94 |
| Max. P | 0.669677 |
| Location | 16,962,789 – 16,962,883 |
|---|---|
| Length | 94 |
| Sequences | 6 |
| Columns | 101 |
| Reading direction | reverse |
| Mean pairwise identity | 89.97 |
| Shannon entropy | 0.18419 |
| G+C content | 0.27703 |
| Mean single sequence MFE | -16.35 |
| Consensus MFE | -13.59 |
| Energy contribution | -13.78 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.11 |
| Mean z-score | -1.62 |
| Structure conservation index | 0.83 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.38 |
| SVM RNA-class probability | 0.669677 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 16962789 94 - 22422827 ---AUGGAUCUGCGAAUUGC-GCAGAUUCGAAACAAAAAUAAAGCA---AACAGUUUAAUAAUGAUAAUGCUAAUAACUAUUGUAGAUAUACAUAUAAAUA ---.((((((((((.....)-)))))))))............((((---....(((....))).....)))).........((((....))))........ ( -17.80, z-score = -2.10, R) >droSim1.chrX 13140683 94 - 17042790 ---AUGGAUCUGCGAAUCGC-GCAGAUUCGAAACAAAAAUAAAGCA---AACAGUUUAAUAAUGAUAAUGCUAAUAACUAUUGUAGAUAUACAUAUAAAUA ---.((((((((((.....)-)))))))))............((((---....(((....))).....)))).........((((....))))........ ( -17.80, z-score = -2.03, R) >droSec1.super_17 796159 94 - 1527944 ---AUGGAUCUGCGAAUCGC-GCAGAUUCGAAACAAAAAUAAAGCA---AACAGUUUAAUAAUGAUAAUGCUAAUAACUAUUGUAGAUAUACAUAUAAAUA ---.((((((((((.....)-)))))))))............((((---....(((....))).....)))).........((((....))))........ ( -17.80, z-score = -2.03, R) >droYak2.chrX 15574520 97 - 21770863 ---AUGGUUCUGCGUAUUGA-GCAGAUUCGAAACAAAAAGAAAGCAAACAACAAUUUAAUAAUGAUAAUGCUAAUAACUAUUGUAGAUAUACAUAUAAAUA ---.((..(((((.......-)))))..))............((((.......(((....))).....)))).........((((....))))........ ( -10.90, z-score = 0.38, R) >droEre2.scaffold_4690 7316016 97 - 18748788 ---AUGGGUCUGCAAAUUGA-GCAGACUCGAAACAAAAAGAAAGCAAACAACAGUUUAAUAAUGAUAAUGCUAAUAACUAUUGUAGAUAUACAUAUAAAUA ---.(((((((((.......-))))))))).................((((.((((.....((....))......)))).))))................. ( -16.80, z-score = -2.00, R) >droAna3.scaffold_13334 777850 101 + 1562580 AAGGGGACUCUGCCAUUAAAGGCAGAUCCGAAACAAAAAGAAAGCAAACAACAGUUUAAUAAUGAUAAUGCUAAUAACUACUGUAGAUAUACAUAUAAAUA ....(((.((((((......))))))))).............((((.......(((....))).....)))).........((((....))))........ ( -17.00, z-score = -1.96, R) >consensus ___AUGGAUCUGCGAAUUGA_GCAGAUUCGAAACAAAAAGAAAGCA___AACAGUUUAAUAAUGAUAAUGCUAAUAACUAUUGUAGAUAUACAUAUAAAUA .....((((((((........)))))))).............((((.......(((....))).....)))).........((((....))))........ (-13.59 = -13.78 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:51:19 2011