Sequence ID | dm3.chrX |
---|---|
Location | 16,876,293 – 16,876,348 |
Length | 55 |
Max. P | 0.853988 |
Location | 16,876,293 – 16,876,348 |
---|---|
Length | 55 |
Sequences | 4 |
Columns | 55 |
Reading direction | forward |
Mean pairwise identity | 57.58 |
Shannon entropy | 0.69055 |
G+C content | 0.35909 |
Mean single sequence MFE | -8.82 |
Consensus MFE | -3.92 |
Energy contribution | -3.42 |
Covariance contribution | -0.50 |
Combinations/Pair | 1.82 |
Mean z-score | -1.13 |
Structure conservation index | 0.44 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.93 |
SVM RNA-class probability | 0.853988 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 16876293 55 + 22422827 GGCAUUGCCUCCAUCUCGAUUGCCAUAAAGCCAAAGAGUUAUGUUCAAAUUUUCA (((...)))..((((((....((......))....)))..)))............ ( -5.30, z-score = 0.80, R) >droPer1.super_30 766859 55 - 958394 GGAAAUGCCUUGAAUUUAAAUAGAAUUCAGCGUACAAAUCAUUUUCCCAUUUCCC (((((((..((((((((.....)))))))).(.......).......))))))). ( -9.50, z-score = -2.28, R) >dp4.chrXL_group1e 1004527 55 + 12523060 GGAAAUGCCUUGAAUUUAAAUAGAAUUCAGUGUACAAAUCAUUUUCCCAUUUCCC (((((((...(((((((.....)))))))(((.......))).....))))))). ( -10.70, z-score = -2.57, R) >droGri2.scaffold_14853 9696924 55 - 10151454 GGGUUUAUUUCGGUUCCGGUUCCGGUUAAGGUUAUGAAUUGGAUUCAUAUUUUUA (((((((.((((...(((....))).........)))).)))))))......... ( -9.80, z-score = -0.46, R) >consensus GGAAAUGCCUCGAAUUCAAAUACAAUUAAGCGUACAAAUCAUUUUCACAUUUCCA (((((((.((((......................)))).)))))))......... ( -3.92 = -3.42 + -0.50)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:51:01 2011