Sequence ID | dm3.chrX |
---|---|
Location | 16,840,775 – 16,840,838 |
Length | 63 |
Max. P | 0.980705 |
Location | 16,840,775 – 16,840,838 |
---|---|
Length | 63 |
Sequences | 6 |
Columns | 66 |
Reading direction | forward |
Mean pairwise identity | 81.04 |
Shannon entropy | 0.35957 |
G+C content | 0.41186 |
Mean single sequence MFE | -19.88 |
Consensus MFE | -14.22 |
Energy contribution | -13.42 |
Covariance contribution | -0.80 |
Combinations/Pair | 1.50 |
Mean z-score | -2.32 |
Structure conservation index | 0.71 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.05 |
SVM RNA-class probability | 0.980705 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 16840775 63 + 22422827 ---UAUAGUCCACAUGGUCACAGAAUUGGGUAAUUGAAUGUGGAUUCGUAUUCGUGAUUGUGUGUG ---.......((((..(((((.(((((((((.((.....))..))))).)))))))))..)))).. ( -17.90, z-score = -2.08, R) >droEre2.scaffold_4690 7194266 66 + 18748788 GGUGCGAGUCCACAUGGCCACAGAAUUGGAUAAUUGAAUGUGGAUUCGUAUUCGUGAUUGUAUGUG (((((((((((((((..(((......)))........))))))))))))))).............. ( -21.20, z-score = -2.30, R) >droYak2.chrX 15450821 63 + 21770863 ---CGUAGUCCACAUGGUCACAGAAUUGGGCAAUUGAAUGUGGAUUCGUAUUCGUGAUUGUGUGCG ---.......((((..(((((..((((....))))(((((((....))))))))))))..)))).. ( -17.00, z-score = -0.91, R) >droSec1.super_17 674309 63 + 1527944 ---GAUAGUCCACAUGGUCACAGAAUUGGGUAAUUGAAUGUGGAUUCGUAUUCGUGAUUGUGUGUG ---.......((((..(((((.(((((((((.((.....))..))))).)))))))))..)))).. ( -17.90, z-score = -1.83, R) >droSim1.chrX_random 4379429 63 + 5698898 ---GAUAGUCCACAUGGUCACAGAAUUGGGUAAUUGAAUGUGGAUUCGUAUUCGUGAUUGUGUGUG ---.......((((..(((((.(((((((((.((.....))..))))).)))))))))..)))).. ( -17.90, z-score = -1.83, R) >droGri2.scaffold_14853 6002921 63 + 10151454 ---UAUUUUCUACGCACACACACAUUUACAUAUUUAUACGUGUGUUUGUGUUUGUGUGUGUGUGUG ---.........(((((((((((((..(((((..(((....)))..)))))..))))))))))))) ( -27.40, z-score = -4.96, R) >consensus ___GAUAGUCCACAUGGUCACAGAAUUGGGUAAUUGAAUGUGGAUUCGUAUUCGUGAUUGUGUGUG ..........(((((((((((.(((((((((............))))).))))))))))))))).. (-14.22 = -13.42 + -0.80)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:50:58 2011