| Sequence ID | dm3.chrX |
|---|---|
| Location | 16,487,776 – 16,487,836 |
| Length | 60 |
| Max. P | 0.893938 |
| Location | 16,487,776 – 16,487,836 |
|---|---|
| Length | 60 |
| Sequences | 6 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 82.27 |
| Shannon entropy | 0.34666 |
| G+C content | 0.31107 |
| Mean single sequence MFE | -12.13 |
| Consensus MFE | -10.51 |
| Energy contribution | -10.68 |
| Covariance contribution | 0.17 |
| Combinations/Pair | 1.35 |
| Mean z-score | -1.32 |
| Structure conservation index | 0.87 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.11 |
| SVM RNA-class probability | 0.893938 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 16487776 60 + 22422827 AUUCGAUAUAAAUAAACACGGAACACCGUUUGUGUUUAUUAUAUUACGACGUGUCUGUAU ....(((((((.((((((((((......)))))))))))))))))............... ( -12.50, z-score = -1.03, R) >droSim1.chrX_random 4325117 60 + 5698898 AUUCGAUAUAAAUAAACACGAAACACGGUUUGUGUUUAUUAUAUUACGACGUGUCUGCAU ....(((((((.((((((((((......)))))))))))))))))............... ( -12.90, z-score = -1.46, R) >droSec1.super_17 311026 57 + 1527944 AUUCGAUACGAGUAAACACGAUACUCGGUUUGUGUUUAUUAUAUUACGACGUGUCUG--- ....(((((((((((((((((........))))))))))).........))))))..--- ( -15.40, z-score = -1.94, R) >droYak2.chrX 10593785 57 + 21770863 AUUCGAUAUAAAUAAACACGAAA---GGUUUGUGUUUAUUAUAUUACGACGUGUCUGCAU ....(((((((.(((((((((..---...))))))))))))))))............... ( -11.80, z-score = -1.44, R) >droEre2.scaffold_4690 6846169 57 + 18748788 AUUCGAUAUAAAUAAACACGAAA---GAUUUGUGUUUAUUAUAUUACGACGUGUCUGCAU ....(((((((.(((((((((..---...))))))))))))))))............... ( -11.80, z-score = -1.67, R) >droAna3.scaffold_13117 457623 56 + 5790199 ACUUGAUAUAAAUAAACAUAUUGAAAGGGUU-UGUUUUGUGUAUUACG---UGUCUGCAU ((.(((((((...(((((..((....))...-)))))..))))))).)---)........ ( -8.40, z-score = -0.40, R) >consensus AUUCGAUAUAAAUAAACACGAAACACGGUUUGUGUUUAUUAUAUUACGACGUGUCUGCAU ....((((((.(((((((((((......)))))))))))))))))............... (-10.51 = -10.68 + 0.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:50:01 2011