| Sequence ID | dm3.chrX |
|---|---|
| Location | 15,346,514 – 15,346,582 |
| Length | 68 |
| Max. P | 0.980401 |
| Location | 15,346,514 – 15,346,582 |
|---|---|
| Length | 68 |
| Sequences | 6 |
| Columns | 68 |
| Reading direction | reverse |
| Mean pairwise identity | 70.54 |
| Shannon entropy | 0.56401 |
| G+C content | 0.65843 |
| Mean single sequence MFE | -28.22 |
| Consensus MFE | -20.02 |
| Energy contribution | -20.92 |
| Covariance contribution | 0.90 |
| Combinations/Pair | 1.57 |
| Mean z-score | -1.33 |
| Structure conservation index | 0.71 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.05 |
| SVM RNA-class probability | 0.980401 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 15346514 68 - 22422827 UCCGUCGUCUCCGGCGCCGCGUCCCGAUUCGGUUAUGGAUUCGGGUGUGGAACCGGUUGGCGAAUCGG .((((((((.((((..(((((.(((((.((.......)).))))))))))..))))..)))))..))) ( -34.80, z-score = -2.76, R) >droEre2.scaffold_4690 7062406 61 + 18748788 UCCCUCGUCCCCGGCGCCGCGGCCCGAUUCGGGUGCGGAACCGGUUGGCGAAUCGG-UAACG------ .((.(((((.((((..(((((.((((...)))))))))..))))..)))))...))-.....------ ( -28.80, z-score = -0.75, R) >droYak2.chrX 9535062 68 - 21770863 UCCGUCGUCUCCGGCGCCGCGGUCCGAUUCGUCUAUGGAUUCGGGUGCAGAACCGGUUGGCGAAUCGG .(((((((.....)))..)))).((((((((((..(((.(((.......))))))...)))))))))) ( -27.10, z-score = -0.50, R) >droSec1.super_73 36289 68 - 167737 UCCGUCGUCUCCGGCGCCGCGUACCGAUUCGGUUAUGGAUUCGGGUGUGGAACCGGUUGGCGAAUCGG .((((((((.((((..((((...((((.((.......)).))))..))))..))))..)))))..))) ( -30.20, z-score = -1.50, R) >droSim1.chrX 11857322 68 - 17042790 UCCGUCGUCUCCGGCGCCGCGUCCCGAUUCGGUUAUGGAUUCGGGUGUGGAACCGGUUGGCGAAUCGG .((((((((.((((..(((((.(((((.((.......)).))))))))))..))))..)))))..))) ( -34.80, z-score = -2.76, R) >anoGam1.chrX 9077493 61 + 22145176 UCUCCCUUCCCUCGCACUUUUCCCCUCUUUUGCCA--AACCCGGGCCGGGCACGGUCCGACGC----- ...................................--....(((((((....)))))))....----- ( -13.60, z-score = 0.29, R) >consensus UCCGUCGUCUCCGGCGCCGCGUCCCGAUUCGGUUAUGGAUUCGGGUGUGGAACCGGUUGGCGAAUCGG ....(((((.((((..((((((((.((((((....)))))).))))))))..))))..)))))..... (-20.02 = -20.92 + 0.90)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:46:19 2011