Sequence ID | dm3.chr2L |
---|---|
Location | 11,408,047 – 11,408,123 |
Length | 76 |
Max. P | 0.990222 |
Location | 11,408,047 – 11,408,123 |
---|---|
Length | 76 |
Sequences | 7 |
Columns | 78 |
Reading direction | forward |
Mean pairwise identity | 73.17 |
Shannon entropy | 0.52084 |
G+C content | 0.44202 |
Mean single sequence MFE | -23.17 |
Consensus MFE | -11.68 |
Energy contribution | -13.16 |
Covariance contribution | 1.47 |
Combinations/Pair | 1.15 |
Mean z-score | -2.41 |
Structure conservation index | 0.50 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.41 |
SVM RNA-class probability | 0.990222 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 11408047 76 + 23011544 AAAUCUUCGGGGAAUCUCGAAGAAUAUGGGGUACCAUAUUUUUCCAUAUGUGUGUGGG--AGCUUCCCCACAGCAGCC ........((((((.((((((((((((((....)))))))))))((((....)))).)--)).))))))......... ( -29.70, z-score = -3.43, R) >droSim1.chr2L 11216407 76 + 22036055 AAAUCUUCGGGGAAUCUCGAAGAAUAUGGGGUACCAUAUUUUUCCAUAUGUGUGUGGG--AGCAUCCCCACAGCAGCC ........(((((..((((((((((((((....)))))))))))((((....)))).)--))..)))))......... ( -27.40, z-score = -2.69, R) >droSec1.super_3 6802865 76 + 7220098 AAAUCUUCGGGGAAUCUCGAAGAAUAUGGGGUACCAUAUUUUUCCAUAUGUGUGUGGG--AGCAUCCCCACAGCAGCC ........(((((..((((((((((((((....)))))))))))((((....)))).)--))..)))))......... ( -27.40, z-score = -2.69, R) >droYak2.chr2L 7807047 76 + 22324452 AAAUCUUCGGGGAAUCUCGAGGAAUAUGGGGUACCAUAUUUUUCCAUAUGUGUGUGGG--AGCUUCCCCGCUGCAGCC .......(((((((.((((((((((((((....)))))))))))((((....)))).)--)).)))))))........ ( -30.20, z-score = -2.87, R) >droEre2.scaffold_4929 12609667 62 - 26641161 AAAUCUUCGGGGAAUCUCGAAGAAUAUGGGCUACCAUAUUUUUCCAUACGUGUGCGGG--AGCU-------------- ...((((((((....))))))))((((((....)))))).(((((.((....)).)))--))..-------------- ( -18.30, z-score = -1.89, R) >droPer1.super_1 8307249 76 + 10282868 AGAAUUUCAAAGAAACCC-AAAAAUAUAGGAAACAAUAUUUUUCCAUACGAGUAUGUGCCAGGGAGUAGGUGGAAGA- ....(((((...(..(((-((((((((.(....).)))))))).((((....)))).....)))..)...)))))..- ( -15.20, z-score = -1.79, R) >dp4.chr4_group3 6858915 71 + 11692001 -----UUCAAAGAAACCC-AAAAAUAUAGGAAACAAUAUUUUUCCAUACGAGUAUGUGCCAGGGAGUAGGUGGAAGA- -----((((...(..(((-((((((((.(....).)))))))).((((....)))).....)))..)...))))...- ( -14.00, z-score = -1.50, R) >consensus AAAUCUUCGGGGAAUCUCGAAGAAUAUGGGGUACCAUAUUUUUCCAUAUGUGUGUGGG__AGCUUCCCCACAGCAGCC ....(((((((....)))))))(((((((....)))))))..((((((....)))))).................... (-11.68 = -13.16 + 1.47)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:32:32 2011