| Sequence ID | dm3.chrX |
|---|---|
| Location | 14,846,841 – 14,846,905 |
| Length | 64 |
| Max. P | 0.811962 |
| Location | 14,846,841 – 14,846,905 |
|---|---|
| Length | 64 |
| Sequences | 3 |
| Columns | 67 |
| Reading direction | forward |
| Mean pairwise identity | 46.46 |
| Shannon entropy | 0.76358 |
| G+C content | 0.30778 |
| Mean single sequence MFE | -10.93 |
| Consensus MFE | -4.02 |
| Energy contribution | -3.37 |
| Covariance contribution | -0.66 |
| Combinations/Pair | 1.50 |
| Mean z-score | -1.19 |
| Structure conservation index | 0.37 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.77 |
| SVM RNA-class probability | 0.811962 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 14846841 64 + 22422827 AAUCAUGUUUCUAUGAUAGAGAUCUUCGAAAUGUUAACGUUUCGGAUCAUUUUUUUUUUUAAAU--- .((((((....))))))...((((..(((((((....)))))))))))................--- ( -13.60, z-score = -2.23, R) >droSec1.super_32 301926 50 + 562834 -AUCAUGUUGCAAUGCUAGAGAUC---GAAAUGUUAACGUUUCGU-UUAUGUUGA------------ -.........(((((.((((...(---((((((....))))))))-)))))))).------------ ( -8.20, z-score = -0.08, R) >droAna3.scaffold_12928 722022 66 + 771024 AAUGGUUCUAUCAUUAU-GCGAUUCACAUGGUUUUGAUAUCGCGAAUAGUUCCUUCUUACAUUCUAA ...((..((((.....(-((((((((........))).)))))).))))..)).............. ( -11.00, z-score = -1.26, R) >consensus AAUCAUGUUACAAUGAUAGAGAUC__CGAAAUGUUAACGUUUCGAAUAAUUUUUU_UU__A______ .(((((......))))).........(((((((....)))))))....................... ( -4.02 = -3.37 + -0.66)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:44:51 2011