| Sequence ID | dm3.chrX |
|---|---|
| Location | 13,813,236 – 13,813,297 |
| Length | 61 |
| Max. P | 0.964760 |
| Location | 13,813,236 – 13,813,297 |
|---|---|
| Length | 61 |
| Sequences | 8 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 74.23 |
| Shannon entropy | 0.54829 |
| G+C content | 0.62262 |
| Mean single sequence MFE | -16.68 |
| Consensus MFE | -8.22 |
| Energy contribution | -8.35 |
| Covariance contribution | 0.13 |
| Combinations/Pair | 1.36 |
| Mean z-score | -1.94 |
| Structure conservation index | 0.49 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.74 |
| SVM RNA-class probability | 0.964760 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chrX 13813236 61 + 22422827 CGCGACCCUGACCCGCAACAACAUGUUGCAUGUUGAGCGUA-CGCCAGCAACAGAUCACGCC .(((...(((....(((((.....))))).(((((.((...-.))))))).)))....))). ( -19.40, z-score = -2.79, R) >droSim1.chrX 10626944 61 + 17042790 CGCGACCCUGACCCGCAACAACAUGUUGCACGUUGAGCACC-CGCCAGCAACAGAUCCCGCC .(((...(((....(((((.....)))))..((((.((...-.))))))..)))....))). ( -18.20, z-score = -3.63, R) >droSec1.super_20 459469 61 + 1148123 CGCGACCCUGACCCGCAACAACAUGUUGCACGUUGAGCACC-AGACAGCAACAGAUCCCGCC .(((...(((....(((((.....)))))..((((......-...))))..)))....))). ( -14.10, z-score = -2.04, R) >droYak2.chrX 8107191 62 + 21770863 CGCGACCCUGACCCGCAACAACAUGUUGCAUGUUGUGCCCCGCACCAGCCACAGAUCAUGCA .(((...(((....(((((.....)))))..(((((((...))).))))..)))....))). ( -15.60, z-score = -1.15, R) >droEre2.scaffold_4690 5674823 61 - 18748788 CGCGACCCUGACCCGCAACAACAUGUUGCAUGUUGAGCCAC-CGCCAGCCGCAGAUAAUGCC .(((..........(((((.....)))))..((((.((...-.))))))))).......... ( -15.60, z-score = -2.00, R) >droPer1.super_21 239139 58 - 1645244 CUCGACCCUGACCCGCAGCAACAUGUUGUGUUGCAUGUUGCCUGCCC-CCGCCCCCGCC--- ..............((((((((((((......)))))))).))))..-...........--- ( -16.70, z-score = -3.28, R) >droMoj3.scaffold_6359 1463689 51 - 4525533 --CGACCCUGACCCGCAGCAACAUGUUGCAUGUUGUGUGCCCCGCUAGCAGCA--------- --............(((((((((((...)))))))).)))...((.....)).--------- ( -12.20, z-score = 0.08, R) >droGri2.scaffold_15081 2697387 62 - 4274704 UGCGACCCUGACCCGCAGCAACAUGUUGCAUGUUGUGUGCCCCGCCAGCCAGAAGCGGCGGC ((((.........))))((((((((...)))))))).....(((((.((.....))))))). ( -21.60, z-score = -0.73, R) >consensus CGCGACCCUGACCCGCAACAACAUGUUGCAUGUUGAGCGCC_CGCCAGCAACAGAUCACGCC ..............(((((.....)))))..((((.((.....))))))............. ( -8.22 = -8.35 + 0.13)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 01:41:32 2011